Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Brief Report
Case Report
Case Series
Current Issue
Editorial
Erratum
Guest Editorial
Letter to the Editor
Media & News
Narrative Review
Notice of Retraction
Original Article
Original Research
Review Article
Short Communication
Short Communications
Systematic Review and Meta-analysis
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Brief Report
Case Report
Case Series
Current Issue
Editorial
Erratum
Guest Editorial
Letter to the Editor
Media & News
Narrative Review
Notice of Retraction
Original Article
Original Research
Review Article
Short Communication
Short Communications
Systematic Review and Meta-analysis
View/Download PDF

Translate this page into:

Original Article
13 (
03
); 337-342
doi:
10.1055/s-0042-1755597

Detection of Novel gyrB Mutation in Fluoroquinolone-Resistant Salmonella and Escherichia coli using PCR-RFLP

Nitte University Center for Science Education and Research, Division of Infectious Diseases, Paneer Campus, Nitte (Deemed to be University), Deralakatte, Mangaluru, Karnataka, India
Department of Microbiology, Madras Medical Mission, Chennai, Tamil Nadu, India

Address for correspondence Vijaya Kumar Deekshit, PhD, Nitte University Center for Science Education and Research (NUCSER), Kotekar Beeri Road, Paneer campus, Nitte (Deemed to be University), Deralakatte, Mangalore, Karnataka, 575018, India (e-mail: deekshit1486@nitte.edu.in)

Licence
This is an open access article published by Thieme under the terms of the Creative Commons Attribution License, permitting unrestricted use, distribution, and reproduction so long as the original work is properly cited. (https://creativecommons.org/licenses/by/4.0/)
Disclaimer:
This article was originally published by Thieme Medical and Scientific Publishers Pvt. Ltd. and was migrated to Scientific Scholar after the change of Publisher.

Abstract

Background

Emergence of fluoroquinolone resistance in gut pathogens is a cause of concern. Resistant to quinolone is mainly due to the point mutations at the quinolone-resistance determining regions (QRDR). The aim of the study was to develop polymerase chain reaction-restriction fragment length polymorphism assay (PCR-RFLP) to detect QRDR mutations in gyrA and gyrB regions in enteric pathogens.

Methodology

PCR-RFLP was done for gyrA 83 region using HinfI and for gyrB 447 using AcuI for fluoroquinolone resistant and susceptible gut pathogens. The products were also sequenced to confirm the presence of restriction sites.

Results

In this study, a PCR-RFLP technique was developed to detect gyrA 83 mutations in Salmonella typhi and Escherichia coli. A first of its kind PCR-RFLP was also developed to detect gyrB 447 mutation using a restriction enzyme AcuI. Restriction digestion of gyrA using HinfI resulted in three bands for resistant S. typhi isolates due to the presence of mutation at gyrA 83 and four bands were seen for sensitive S. typhi isolates, while two bands for resistant and three bands were seen in sensitive E. coli isolates. Similarly, restriction digestion of gyrB using AcuI resulted in no digestion for resistant S. typhi isolates and two bands for resistant E. coli isolates. This suggest that there is mutation at gyrB 447 region ofE. coli, while no mutation was found in S. typhi isolates.

Conclusion

The PCR-RFLP developed in the present study could successfully detect gyrA 83 and gyrB 447 mutations in fluoroquinolone-resistant S. typhi and E. coli. The technique can be efficiently used in epidemiological studies instead of a cost-intensive sequencing method to detect the status of multiple point mutations in gut pathogens.

Keywords

Escherichia coli
fluoroquinolone resistance
QRDR mutations
Salmonella typhi

Introduction

The term antibiotic is arguably the most common and powerful term in today's medical microbiology. Antibiotics when used suitably can save lives. Combined with their high productivity and low secondary effect, usage of antibiotics has been highly exploited leading to the emergence of antibiotic resistance. Antibiotic resistance is increasing in high levels globally, bringing about higher medical costs and fatality rate. Salmonella and Escherichia coli are the gram-negative human enteric pathogens capable of causing mild-to-severe infections.123 It is chiefly contracted by ingestion of contaminated food or water. Fluoroquinolones are the drug of choice since several decades for the infection caused by these enteric pathogens.45 The most frequently used fluoroquinolones are ciprofloxacin, levofloxacin, and moxifloxacin. Fluoroquinolones impair DNA replication when administered at a lower concentration or induce cell death when given at a lethal concentration by targeting DNA gyrase and topoisomerase IV, hence inhibiting their influence of supercoiling within the cell. The potency differs in different bacteria. Binding of fluoroquinolones to DNA gyrase or topoisomerase IV prevents religation of the DNA substrate. This DNA, enzyme, and drug complex formation is an important step in the fluoroquinolone killing pathway. However, as a result of their extensive use, the emergence of fluoroquinolone resistance has become increasingly prevalent in recent times.56 Resistance to fluoroquinolones in Enterobacteriaceae can be mainly attributed to the development of spontaneous mutations in the topoisomerase II or topoisomerase IV regions, presence of plasmid mediated quinolone resistance genes, or overexpression of efflux pumps.78 However, point mutations in the QRDRs (quinolone resistance determining regions) such as gyrA, parC, gyrB, and parE regions are the most commonly encountered mechanisms in fluoroquinolone resistance in bacterial pathogens.79 QRDR mutations modify structure of the target protein, thereby altering the binding affinity of fluoroquinolone to enzyme, leading to drug resistance.10 These mutations can be precisely detected by sequencing and polymerase chain reaction-restriction fragment length polymorphism assay (PCR-RFLP) or MAMA-PCR.11 In this study, we have developed a rapid PCR-RFLP technique for the first time to detect gyrA (Ser 83) and gyrB (Ser 447) mutations in fluoroquinolone resistant Salmonella typhi and E. coli.

Materials and Methods

Bacterial Isolates

A total of 10 S. typhi isolates and 30 E. coli isolates were revived from the institutional repository. Ten microliters of the samples were used to inoculate into 5 mL LB (Luria Bertani) Broth (HiMedia Laboratories Pvt. Ltd., India) and incubated at 37°C with shaking until light-to-moderate turbidity was obtained. The turbidity was compared with that of standard 0.5 McFarland unit. These freshly revived overnight grown cultures were then subjected to DNA extraction for further studies.

Antimicrobial Susceptibility Assay

Antimicrobial susceptibility test was performed for all the isolates using antibiotics such as nalidixic acid (30 µg) and ciprofloxacin (5 µg) on Mueller Hinton (MH) agar (HiMedia, Laboratories Pvt. Ltd., India) using disc diffusion method as described by standard guidelines.12 Bacterial culture lawns were prepared on well-dried MH agar plates by swabbing from cultures grown for 18 to 24 hours with 0.5 McFarland unit in 5 mL LB broth. Antibiotic discs were aseptically placed on the medium surface containing the lawn of bacteria and were incubated at 37°C for 16 to 18 hours. The isolates were then designated as sensitive, intermediate, or resistant based on the zone of inhibition by comparing with the interpretive chart of Kirby-Bauer. E. coli ATCC 25922 and S. typhimurium (ST14028) were used as quality control strains.

PCR Assay

The DNA from all the bacterial isolates was extracted and subjected to PCR for checking the presence of genus-specific gene invA for Salmonella and uidA gene for E. coli (Table 1).1314 The PCR was performed in a thermal cycler. The 30 μL volumes of master mix consist 3 μL of 10X buffer, 50 μM concentrations each of dNTPs, 10 pmol of forward and backward primers and 1.0 U of Taq DNA polymerase (HiMedia Laboratories Pvt Ltd., India), with 2.0 μL of template DNA. The reaction was done at an annealing temperature of 64°C. The PCR amplified products were subjected to electrophoresis on ethidium bromide stained 1.5% agarose gel, and bands were visualized using Gel Documentation system (BioRad, California, United States).

Table 1 Oligonucleotide primers used in the study

Gene name

Oligonucleotides (5′-3′)

Product size (bp)

Annealing temperature

invA

F - GTGAAATTATCGCCACGTTCGGGCAA

R - TCATCGCACCGTCAAAGGAACC

284 bp

64°C

uidA

F - AAAACGGCAAGAAAAAGCAG

R - ACGCGTGGTTACAGTCTTGCG

146 bp

63°C

gyrA

F - GACCTTGCGAGAGAAATTACAC

R - GATGTTGGTTGCCATACCTACG

540 bp

57°C

gyrB

F - CAAACTGGCGGACTGTCAGG

R - TTCCGGCATCTGACGATAGA

346 bp

55°C

PCR- RFLP for the Detection of gyrA and gyrB Point Mutations

Fluoroquinolone-resistant isolates were chosen for PCR-RFLP to detect the presence of mutation in the QRDR regions. PCR-PFLP was targeted toward restriction sites at gyrA 83 and gyrB 447 positions using two different restriction enzymes HinfI and AcuI, respectively. PCR was performed as described earlier using forward and reverse primers of gyrA and gyrB. The primers used are listed in Table 1. PCR reactions were performed using a thermal cycler (Bio-Rad, California, United States) with an annealing temperature of 55°C for 30 seconds. The obtained PCR products were digested using respective enzymes. Enzyme digestion was performed in a 20 μL mixture containing 16 μL (0.1–0.5 mg) of the PCR product, 0.5 μL (2 IU) of enzyme, 2 μL of 10X buffer, and 1.5 μL of sterile ultrapure water at 37°C for 2 hours followed by termination of enzyme activity at 65°C for 10 minutes using a dry bath. The digested PCR products were electrophoresed and visualized using a Gel Documentation system (Bio-Rad, California, United States).

DNA Sequencing

The gyrA and gyrB PCR products of fluoroquinolone-resistant E. coli and S. typhi were sent for sequencing (Biokart India Pvt Ltd) and the obtained sequences were analyzed using NCBI-BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The amino acid sequences of corresponding genes were obtained from the Expasy translate tool (https://web.expasy.org/translate/) and the sequences were submitted to GenBank.

Results

Antibiogram Analysis

The S. typhi isolates were positive for invA and E. coli isolates were positive for uidA gene. The strains were also resistant to both nalidixic acid and ciprofloxacin.

PCR-RFLP

PCR-RFLP was done for all the isolates for the detection of QRDR mutation in gyrA and gyrB regions. Restriction digestion by HinfI for gyrA resulted in three bands (337 bp, 149bp, and 54 bp) for resistant S. typhi isolates (S16 & S20) due to the presence of mutation at gyrA 83 position and four bands (238 bp, 149 bp, 99 bp, and 54 bp) for sensitive S. typhi isolates while two bands (337 bp and 203 bp) for resistant (J4) and three bands (239 bp, 202 bp, and 99 bp) were seen in sensitive E. coli isolates. Similarly, restriction digestion by the restriction enzyme AcuI for gyrB resulted in no digestion for resistant S. typhi isolates and two bands (142 bp and 204 bp) for nine resistant E. coli isolates. These suggest that there is mutation at gyrB 447 region of E. coli, while no mutation was found in S. typhi isolates (Fig. 1).

Fig. 1 Agarose gel electrophoresis of polymerase chain reaction-restriction fragment length polymorphism assay products of gyrB at 447th position with mutation. Lane M: 100bp marker, Lane 1: fluoroquinolone-resistant Escherichia coli (J4), Lane 2–5: fluoroquinolone-resistant Salmonella typhi isolates.
Fig. 1 Agarose gel electrophoresis of polymerase chain reaction-restriction fragment length polymorphism assay products of gyrB at 447th position with mutation. Lane M: 100bp marker, Lane 1: fluoroquinolone-resistant Escherichia coli (J4), Lane 2–5: fluoroquinolone-resistant Salmonella typhi isolates.

DNA Sequencing

The resistant isolates (S16, S20, J4) that showed mutation at gyrA 83 region were selected for sequencing for further confirmation (Figs. 2 and 3). The sample S16 showed gyrA mutation at position 83 with an amino acid substitution for serine with tyrosine (TCG to TAC). The gyrA region of fluoroquinolone sensitive S. typhi contains 3 restriction sites for the enzyme HinfI. In the case of resistant S. typhi (S16), there is an abolishment of one of the sites at the 83rd position resulting in only three bands of 337 bp, 149 bp, and 54 bp upon digestion. However, in the case of E. coli the sample J4 showed mutation at position 83 with an amino acid substitution for serine with leucine (TCG to TTG). The gyrA region of fluoroquinolone sensitive E. coli contains two restriction sites for the enzyme HinfI. In the case of resistant E. coli (J4), there is an abolishment of one of the sites at the 83rd position resulting in only two bands of 337 bp and 203 bp upon digestion. Similar mutations were seen in other E. coli isolates (CP092819, CP055022, CP091169) and in S. typhi (CP030749, CP082409, CP074335) for gyrA.

Fig. 2 DNA sequence analysis of representative fluoroquinolone-resistant Salmonella typhi (S16) showing mutation at gyrA gene at amino acid position 83 with restriction sites for the enzyme HinfI.
Fig. 2 DNA sequence analysis of representative fluoroquinolone-resistant Salmonella typhi (S16) showing mutation at gyrA gene at amino acid position 83 with restriction sites for the enzyme HinfI.
Fig. 3 DNA sequence analysis of representative fluoroquinolone-resistant Escherichia coli isolate (J4) showing mutation at gyrA gene at amino acid position 83 with restriction sites for the enzyme HinfI.
Fig. 3 DNA sequence analysis of representative fluoroquinolone-resistant Escherichia coli isolate (J4) showing mutation at gyrA gene at amino acid position 83 with restriction sites for the enzyme HinfI.

The samples S16, S20, and J4 were also sequenced to detect mutation in gyrB region (Figs. 4 and 5). Both the S. typhi (S16 and S20) strains showed silent gyrB mutation at position 447 as the codon AAG is changed to AAA, wherein both codes for the amino acid Lysine. The enzyme could not digest the gyrB of S. typhi (S16 and S20) with AAA due to abolishment of restriction site for the enzyme AcuI. However, in the case of E. coli (J4) the isolate did not have any mutation at 447th position of gyrB, thereby allowing AcuI enzyme to digest the region. All the sequences are submitted to GenBank (Accession numbers: MZ826340, MZ826341, MZ826342, MZ826343). Similar mutations were seen in gyrB at 447th position in other E. coli isolates (CP095856, CP095446, CP095454) and in other bacterial pathogens such as Klebsiella pneumoniae (CP091152) and S. typhi (CP034233, CP023470, LS483465).

Fig. 4 DNA sequence analysis of representative fluoroquinolone-resistant Salmonella typhi (S16) showing mutation at gyrB gene at amino acid position 447 with restriction site for the enzyme AcuI.
Fig. 4 DNA sequence analysis of representative fluoroquinolone-resistant Salmonella typhi (S16) showing mutation at gyrB gene at amino acid position 447 with restriction site for the enzyme AcuI.
Fig. 5 DNA sequence analysis of representative fluoroquinolone-resistant Escherichia coli isolate (J4) showing mutation at gyrB gene at amino acid position 447 with restriction site for the enzyme AcuI.
Fig. 5 DNA sequence analysis of representative fluoroquinolone-resistant Escherichia coli isolate (J4) showing mutation at gyrB gene at amino acid position 447 with restriction site for the enzyme AcuI.

Discussion

Gastrointestinal bacteria like Salmonella and E. coli are important human pathogens capable of causing severe infections worldwide including urinary tract infections and gastroenteritis. These infections are usually treated with β-lactams or fluoroquinolones. However, resistance to these antibiotics is a major problem throughout the world. In the present study, a PCR-RFLP technique was developed to detect QRDR mutations in fluoroquinolone-resistant E. coli and Salmonella isolates. Majority of S. typhi isolates used in the study showed resistance to nalidixic acid. This is in agreement with several studies that showed most of the S. typhi clinical isolates of maximum resistance toward nalidixic acid.15 Though multiple point mutations are observed in the QRDR regions of fluoroquinolone resistant strains, the gyA 83 and parC 80 mutations are most commonly encountered changes.11161718 The gyrA 83 PCR-RFLP developed in this study could successfully detect a point mutation at gyrA 83 region of S. typhi and E. coli. This was further confirmed by sequencing of gyrase A region. This is in similar with earlier studies, wherein 94% of the isolates showed gyrA 83 mutation in PCR-RFLP.111920 Since fluoroquinolone resistant is attributed to multiple mutations, it was out interest to look for novel point mutations in other regions such as gyrB. The most common mutations in the gyrB region are gyrB 426, gyrB 447, gyrB 464, and gyrB 466.21 However, all these mutations cannot be detected by PCR-RFLP. Nevertheless, the first of its kind gyrB 447 PCR-RFLP developed in this study could detect a point mutation at gyrB 447 region. However, upon sequencing the mutation was found to be silent with little or no effect on the activity of the enzyme. Further studies are essential to confirm the relevance of gyrB 447 mutation in fluoroquinolone-resistant S. typhi and E. coli.

Conclusion

The PCR-RFLP developed in the present study could detect gyrA 83 and for the first time gyrB 447 mutations in fluoroquinolone-resistant S. typhi and E. coli. Though in the present study none of isolates showed other mutations, it is important to screen these regions to understand the status of QRDR mutations among fluoroquinolone resistant isolates. In addition, the PCR-RFLP developed in the study was found to be an ideal technique to screen large number of drug-resistant bacterial pathogens during epidemiological investigations.

Compliance with Ethical Standards

The isolates used in the study were obtained from the institutional repository. However, all the ethical standards have been included in the study before performing the experiments.

Conflict of interest

None declared.

Conflict of interest

None declared.

Funding The financial support received from Nitte (Deemed to be University) in the form of an intramural student grant (NU/DR/NUSR2/NUCSER/2019-20/08) is gratefully acknowledged.

References

  1. , . Salmonella species. In Food Microbiology:Fundamentals and Frontiers. 3rd edition. United States:. American Society of Microbiology; 2007:187–236
    [Google Scholar]
  2. . Salmonella infections in immunocompromised adults. J Infect. 2008;56(06):413-422.
    [Google Scholar]
  3. , , , , , . Re-emergence of the susceptibility of the Salmonella spp. isolated from blood samples to conventional first line antibiotics. Antimicrob Resist Infect Control. 2016;5:22.
    [Google Scholar]
  4. , , , et al.. Increasing resistance to fluoroquinolones in Escherichia coli from urinary tract infections in the Netherlands. J Antimicrob Chemother. 2000;46(02):223-228.
    [Google Scholar]
  5. , , , , , . Life-threatening infantile diarrhea from fluoroquinolone-resistant Salmonella enterica typhimurium with mutations in both gyrA and parC. Emerg Infect Dis. 2003;9(02):255-257.
    [Google Scholar]
  6. , , , . Escherichia coli resistance to fluoroquinolones in community-acquired uncomplicated urinary tract infection in women: a systematic review. Antimicrob Agents Chemother. 2020;64(10):e00862-e20.
    [Google Scholar]
  7. . Emerging mechanisms of fluoroquinolone resistance. Emerg Infect Dis. 2001;7(02):337-341.
    [Google Scholar]
  8. , , , . Fluoroquinolone resistance: mechanisms, impact on bacteria, and role in evolutionary success. Trends Microbiol. 2014;22(08):438-445.
    [Google Scholar]
  9. , , . Quinolone resistance from a transferable plasmid. Lancet. 1998;351((9105):):797-799.
    [Google Scholar]
  10. . Mechanisms of action and resistance of older and newer fluoroquinolones. Clin Infect Dis. 2000;31(02):S24-S28.
    [Google Scholar]
  11. , , , , , . Comparison of mismatch amplification mutation assay PCR and PCR-restriction fragment length polymorphism for detection of major mutations in gyrA and parC of Escherichia coli associated with fluoroquinolone resistance. Microb Drug Resist. 2019;25(01):23-31.
    [Google Scholar]
  12. Clinical and Laboratory Standards Institute, Performance Standards for Antimicrobial Susceptibility Testing; Twenty ninth Informational Supplement M100-S29, Clinical and Labo ratory Standards Institute, CLSI, Wayne, Pa, USA
  13. , , , . Detection of Escherichia coli and Shigella spp. in water by using the polymerase chain reaction and gene probes for uid. Appl Environ Microbiol. 1991;57(04):1013-1017.
    [Google Scholar]
  14. , , , et al.. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes. 1992;6(04):271-279.
    [Google Scholar]
  15. , , , . A systematic review of antimicrobial resistance in Salmonella enterica serovar Typhi, the etiological agent of typhoid. PLoS Negl Trop Dis. 2018;12(10):e0006779.
    [Google Scholar]
  16. , , , , . Differential expression of virulence genes and role of gyrA mutations in quinolone resistant and susceptible strains of Salmonella Weltevreden and Newport isolated from seafood. J Appl Microbiol. 2015;119(04):970-980.
    [Google Scholar]
  17. , , , et al.. Plasmid-mediated fluoroquinolone resistance associated with extra-intestinal Escherichia coli isolates from hospital samples. Indian J Med Res. 2019;149(02):192-198.
    [Google Scholar]
  18. , , , . Quinolone resistance-determining region in the DNA gyrase gyrA gene of Escherichia coli. Antimicrob Agents Chemother. 1990;34(06):1271-1272.
    [Google Scholar]
  19. , , . An extended PCR-RFLP assay for detection of parC, parE and gyrA mutations in fluoroquinolone-resistant Streptococcus pneumoniae. J Antimicrob Chemother. 2004;53(04):682-683.
    [Google Scholar]
  20. , , , et al.. GyrA ser83 and ParC trp106 mutations in Salmonella enterica serovar Typhi isolated from typhoid fever patients in tertiary care hospital. J Clin Diagn Res. 2016;10(07):DC14-DC18.
    [Google Scholar]
  21. , , , et al.. Detection of a novel gyrB mutation associated with fluoroquinolone-nonsusceptible Salmonella enterica serovar Typhimurium isolated from a bloodstream infection in Ghana. Clin Infect Dis. 2016;62(01):S47-S49.
    [Google Scholar]
Show Sections