Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Brief Report
Case Report
Case Series
Current Issue
Editorial
Erratum
Guest Editorial
Letter to the Editor
Media & News
Narrative Review
Original Article
Original Research
Review Article
Short Communication
Short Communications
Systematic Review and Meta-analysis
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Brief Report
Case Report
Case Series
Current Issue
Editorial
Erratum
Guest Editorial
Letter to the Editor
Media & News
Narrative Review
Original Article
Original Research
Review Article
Short Communication
Short Communications
Systematic Review and Meta-analysis
View/Download PDF

Translate this page into:

Original Article
16 (
2
); 260-267
doi:
10.25259/JHASNU_237_2025

In Silico Identification and Characterization of Antigenic Epitopes of BamA from Edwardsiella

Department of Bio and Nano Technology, Nitte University Centre for Science Education and Research, Deralakatte, Mangaluru, Karnataka, India
Central Research Laboratory, K S Hegde Medical Academy, Deralakatte, Mangaluru, Karnataka, India
Department of Bioinformatics and Biostatistics, Nitte University Centre for Science Education and Research, NITTE (Deemed to be University), Deralakatte, Mangaluru, Karnataka, India

*Corresponding author: Dr. Biswajit Maiti, Department of Bio and Nano Technology, Nitte University Centre for Science Education and Research, NITTE (Deemed to be University), Deralakatte, Mangaluru 575018, Karnataka, India. maiti.b@nitte.edu.in

Licence
This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-Share Alike 4.0 License, which allows others to remix, transform, and build upon the work non-commercially, as long as the author is credited and the new creations are licensed under the identical terms.

How to cite this article: Disha S, Ghate SD, Rao RSP, Maiti B. In Silico Identification and Characterization of Antigenic Epitopes of BamA from Edwardsiella. J Health Allied Sci NU. 2026;16:260-7. doi: 10.25259/JHASNU_237_2025

Abstract

Objectives

The global burden of infectious diseases highlights the need for innovative strategies to identify and design effective vaccine candidates for healthcare applications. Subunit vaccines are a major focus of contemporary research, with bacterial outer membrane proteins recognised for their strong immunostimulatory potential. In this study, β-barrel assembly machinery protein A (BamA) was examined using in silico methods to assess its physicochemical properties, immunogenicity, epitope profile, and docking with the fish MHC molecule.

Material and Methods

The gene bamA from an Edwardsiella tarda isolate was cloned and sequenced. Using the sequence, the structure and sub-cellular localisation of BamA were predicted. Homology modelling was performed using SWISS-MODEL, and the potential of BamA as a vaccine candidate was assessed through the Vaxign2 server. Antigenic sites, B-cell epitopes, and cytotoxic T-lymphocyte epitopes were predicted, and common peptides were identified. Molecular docking was carried out to predict the interactions between the selected epitopes and the fish MHC molecules. Immunogenic potential was evaluated using the C-ImmSim server.

Results

The BamA protein was confirmed to be an OMP. Thirteen antigenic sites, 14 B-cell epitopes, and 12 T-cell epitopes were predicted for the protein. The common epitopes were successfully docked to the fish MHC molecule.

Conclusion

The in silico analyses provide valuable insights supporting BamA as a potential vaccine candidate for combating edwardsiellosis.

Keywords

BamA
Infectious diseases
In silico
Outer-membrane protein
Vaccine

INTRODUCTION

Vaccination has played a major role in controlling various infectious diseases, including influenza, smallpox, diphtheria, polio, tetanus, hepatitis, measles, and HPV. Traditional vaccines based on live attenuated or inactivated pathogens can sometimes pose safety risks and generate undesirable immune responses. Subunit vaccines are gaining increasing attention because they offer several advantages, such as requiring a low dose, having stronger immunogenicity, and causing minimal toxicity. Outer membrane proteins (OMPs) are highly immunogenic among the various bacterial components and represent promising targets for developing novel and effective vaccines. Studies have shown that OMPs can elicit strong humoral and cellular-mediated immune responses.[1-4] Additionally, certain OMPs offer cross-protection, helping defend against multiple strains and serotypes.[5]

BamA is an OMP that plays a crucial role in bacteria as the core element of the β-barrel assembly machinery, responsible for inserting and translocating other OMPs. Due to its vital function, BamA remains highly conserved across bacterial species. It is generally a 16-stranded protein and switches its conformation during the assembly and insertion of OMPs.[6]

The accessibility of genomic and proteomic data enables predicting and identifying pathogenic proteins that may serve as potential vaccine candidates. Reverse vaccinology is a computational approach used to predict and identify antigens and epitopes that may offer protective immunity.[7] Epitopes that are recognised by the immune system are key targets in vaccine research. Their ability to trigger immune responses makes them valuable for designing effective vaccines. Combined advancements in bioinformatics, recombinant DNA technology, understanding of host genetics, and pathogen genomes are paving the way for rapid vaccine development. Using in silico computational approaches to identify potential targets, vaccines can be developed at a faster rate. Tools in this field rely on statistical and machine learning approaches and are applied to molecular interaction models such as antigen processing, presentation, and binding.

In this paper, we combined various bioinformatics tools to screen, identify, and predict the immunogenicity and binding ability of BamA, a prospective vaccine candidate, an OMP of the bacterium Edwardsiella.

MATERIAL AND METHODS

Bacterial culture

An environmental isolate of Edwardsiella tarda, PCF08[8] originally obtained from diseased striped catfish (Pangasius hypophthalamus), was selected for the cloning study. The preserved cultures stored at -80°C were retrieved and grown in brain heart infusion (BHI) broth (Sigma-Aldrich, USA).

Amplification of the BamA gene

Genomic DNA was extracted from the isolate using the method described by Ausubel et al.,[9] with minor modifications such as sample volumes, incubation time, and incubation temperature to improve DNA extraction from the target sample. The resulting DNA was resuspended in 1X Tris-EDTA buffer. DNA concentration and purity were determined using a Nanophotometer (Implen, Germany). Polymerase chain reaction (PCR) was used to amplify the gene using the primers, F1 (5’ - ATGCGCCGCCCCCTGATGAC - 3’) and R (5’ - AAATGCCTCTCCTACCTGAA - 3’). The 30 µL reaction mixture contained 3 µL of 10X buffer (HiMedia, India), 0.6 µL of dNTPs, 1 µL of 10 pmol of each primer, and 0.2 µL of Taq polymerase (HiMedia, India). About 2 µL of DNA template (200-400 ng) was added to the reaction. PCR was carried out in a thermocycler (Bio-Rad, USA), with initial denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 1 min, with a final extension at 72°C for 10 min. The PCR products were subjected to gel electrophoresis to confirm amplification.

Cloning and sequencing of the gene

The BamA gene was amplified using the F1 and R primers. The obtained PCR products were purified using the QIAquick PCR purification kit (QIAGEN, Germany). A recombinant vector was then produced using the PCR cloning kit (QIAGEN, Germany) by ligating the gene to the plasmid through U-overhangs. Using the heat shock method, the recombinant vector was transformed into E. coli DH5α competent cells. Positive clones were confirmed through PCR with a gene-specific assay. Plasmids from the positive clones were extracted using QIAprep Spin Miniprep Kit (QIAGEN, Germany) and sequenced by M/S Eurofins Genomics (Bangalore, India).

In silico analysis of the gene

Sequence analysis was performed using the nucleotide Basic Local Alignment Search Tool (n-BLAST; National Centre for Biotechnology Information; https://blast.ncbi.nlm.nih.gov/Blast.cgi), and the final analysed sequence was submitted to GenBank (accession number: ON375393.1). Various bioinformatics tools were employed to assess the vaccine potential of the translated protein sequence.

Prediction of transmembrane beta-barrel

The transmembrane beta-barrel structure was predicted using the Prediction of Transmembrane Beta Barrel (PRED-TMBB) software (http://bioinformatics.biol.uoa.gr/PRED-TMBB/).[10] The overall two-dimensional structure of the protein was also predicted.

Signal peptide and subcellular localisation

The presence of the signal peptide and its corresponding cleavage site on the protein was predicted using Signal IP 6.0 (https://services.healthtech.dtu.dk/services/Signa lP-6.0/).[11] Subsequently, the protein’s subcellular localization was predicted using PSORTb version 3.0 (https://www.psort.org/psortb/).[12]

Homology modelling

The SWISS-MODEL server (https://swissmodel.expasy.org/) was used to perform homology modelling for the protein BamA, followed by validation through protein structure analysis using (ProSA)-web portal (https://prosa.services.came.sbg.ac.at/prosa.php).[13,14]

Assessing BamA as a potential vaccine candidate

BamA was assessed using the Vaxign2 server to predict key vaccine-related properties (https://violinet.org/vaxign2). Antigenic regions within the protein were predicted using the Kolaskar and Tongaonkar antigenicity prediction tool (http://tools.iedb.org/bcell/)[15] on IEDB. The B-cell epitopes of the protein were predicted using the BepiPred 3.0 prediction module (https://services.healthtech.dtu.dk/services/BepiPred-3.0/)[16] with a threshold of 0.1512, and the NetCTL 1.2 server was used to predict the T-cell epitopes (https://services.healthtech.dtu.dk/services/NetCTL-1.2/) with a threshold of 0.75.[17]

Molecular docking and validation

The 2D structure for the selected common epitopes was generated using ChemDraw. These 2D structures were then converted to 3D format using the Open Babel command line program.[18] Subsequently, they were converted to pdbqt format for docking using the ‘mk_prepare_ligand.py’ script in the AutoDockFR command line software suite.[19] The ligand energy was minimised, and the ligand file was prepared according to the software’s requirements. Docking parameters were set as specified by the software, and the best poses were selected based on binding energy. The results files were analysed through Discovery Studio 2020 Client.[20]

The protein sequences of fish MHC molecules were obtained from the UniProt database (https://www.uniprot.org/, last accessed on 29-04-2025). The 3D structure of the protein (PDB:5H5Z) was obtained from the Protein Data Bank (PDB, https://www.rcsb.org/, last accessed on 29-04-2025) in the PDB format. All available PDB structures were complexes with ligands. PDB:5H5Z was the highest resolution structure (1.74 Å, X-ray diffraction) available for Ctenopharyngodon idella (grass carp). It is an MHC class 1 antigen with a sequence length of 275 (A-chain).[21] Chain B and water molecules present in the PDB:5H5Z 3D structure were removed using the Discovery Studio GUI software. The protein was then protonated using the REDUCE command and prepared for docking using the ‘prepare_receptor’ script in the AutoDockFR command line software suite.[19]

The molecular docking of peptides to 5H5Z was performed in AutoDock Vina version 1.2.3 command line software.[22] Binding site coordinates (x, y, and z) were determined based on the cocrystal ligand in the 5H5Z structure and set as a 16 Å × 16 Å × 16 Å grid by using the Receptor Grid Preparation tab in the AutoDock GUI tool. An additional 40 × 40 × 40 Å grid was also set up for blind docking. Default values were used for other parameters, while an exhaustiveness of 32 was used to improve the search space.[22]

Immune simulation

To perform the immune simulations, the C-ImmSim server was used (https://kraken.iac.rm.cnr.it/C-IMMSIM/index.php).[23] C-ImmSim uses the Celada-Seiden model to represent how the humoral and cellular immune systems respond to the designed vaccine. The default parameters were used in the simulation.

RESULTS

Amplification of the BamA gene

The full-length gene encoding BamA of E. tarda was successfully amplified using PCR. The amplification yielded a distinct band of ∼1131 bp [Figure 1a].

(a) Representative image for PCR amplification of the BamA gene of Edwardsiella using respective primers. (b) PCR amplification using vector-specific primers (M13 primer). Lane no. B2, B3, & B9 – Positive colonies of BamA/TamA. PCR: Polymerase chain reaction.
Figure 1:
(a) Representative image for PCR amplification of the BamA gene of Edwardsiella using respective primers. (b) PCR amplification using vector-specific primers (M13 primer). Lane no. B2, B3, & B9 – Positive colonies of BamA/TamA. PCR: Polymerase chain reaction.

Cloning and sequencing of the gene

The cloning was performed using the pDrive vector (QIAGEN, Germany), and the clones were confirmed with gene- and vector-specific primers [Figure 1b]. The recombinant clones were sequenced, and sequence analysis confirmed the identity of the bamA gene. The obtained sequence was aligned and compared with reference sequences (WP_015460694.1, WP_077999961.1, WP_370553083.1) available in NCBI to verify and assess sequence similarity. The confirmed DNA sequence was then submitted to the GenBank repository under accession number ON375393.1.

In silico analysis of the gene

Prediction of Transmembrane beta-barrel

A PRED-TMBB analysis identified the protein as an OMP containing characteristic β-barrel structures, thereby confirming its typical structural features [Figure 2a].

(a): Predicted 2D structure of BamA generated using PRED-TMBB software, highlighting the presence of β-barrel motifs characteristic of outer membrane proteins. Homology model of the Edwardsiella tarda OMP BamA generated using SWISS-MODEL, (b) Side view, (c) Top view.
Figure 2:
(a): Predicted 2D structure of BamA generated using PRED-TMBB software, highlighting the presence of β-barrel motifs characteristic of outer membrane proteins. Homology model of the Edwardsiella tarda OMP BamA generated using SWISS-MODEL, (b) Side view, (c) Top view.

Signal peptide and subcellular localisation

The signal peptide was predicted to span amino acids 1 to 21 with a probability score of 0.96. The subcellular localisation prediction by PSORTb V.3.0 confirmed that BamA of Edwardsiella has a non-cytoplasmic signal peptide, and the protein is localised in the outer membrane, with a score of 9.52.

Homology modelling

Homology modelling using SWISS-MODEL generated about 50 comparable templates, with the top-ranked model (Q6E209.1.A) selected based on the species similarity (E. ictaluri), percentage identity (95.23%), GMQE score (0.90), and Q-MEAN Z-score, predicting a reliable three-dimensional structure of the BamA protein. The predicted model displayed a classical 16-stranded β-barrel structure [Figures 2b and c]. Structural assessment indicated 95.5% of the amino acids were in the favoured region of the Ramachandran plot. ProSA analysis yielded a Z-score of -4.72.

BamA as a potential vaccine candidate

A protein must have certain characteristics to be an efficient vaccine candidate. BamA was predicted as an OMP with an adhesion probability of 0.573. The protein sequence was analysed using Kolasker and Tongaonker antigenicity scale (1990) to identify potential antigenic determinants. Thirteen antigenic sites were determined: MTLALVCALSPLAGQAALLPTR, WGVLPGP, GLGIGAAVAGLYRP, SITLSGYL, GLGVRSY, RIFVTG, AQSLRLQPEVLYRVASQTYLGVGWS, LAQIHYGRSVFSSGPSLSLQY, LASLRYTHY, STYLAL, ETRVLAW, RHGVVAWA, and LPTVGVGYR. Fourteen probable B-cell antigenic epitopes of BamA were identified using the BepiPred 3.0 server, which predicts linear B-cell epitopes based on proprietary algorithms [Table 1]. Twelve peptide sequences were predicted as potential cytotoxic T lymphocyte (CTL) epitopes, based on multiple parameters, including MHC binding affinity, proteasomal C-terminal cleavage, and TAP transport efficiency. These peptides had prediction scores >0.75 [Table 2].

Table 1: List of predicted B-cell epitopes for BamA of E. tarda as determined by Bepipred Linear Epitope Prediction 2.0
Sl. No. Start End Peptide Length
1 21 48 AALLPTRAQIDEWLGHLGGDDRFDPDKG 28
2 60 67 NPELGLGI 8
3 75 89 YRPDPSDTTSQNSSI 15
4 109 115 SFFDNDR 7
5 126 150 DTPTYYWGQGFRAGADDDGRQKYTA 25
6 154 165 RLQPEVLYRVAS 12
7 177 197 AMHAADVKQTDRLAQIHYGRS 21
8 209 219 YDSRDFVPNPR 11
9 229 241 THYTPETGSDTRF 13
10 266 276 GEFTQGAVPWN 11
11 287 297 MRGYYQGRYRD 11
12 308 314 RQKLSWR 7
13 328 336 PNVRELGSS 9
14 348 352 FAFKP 5
Table 2: List of predicted CTL epitopes for BamA of E. tarda as determined by NetCTL 1.2
Residue number Peptide sequence Predicted MHC binding affinity Rescale binding affinity C-terminal cleavage affinity Transport affinity Prediction score MHC ligands
29 QIDEWLGHL 0.1300 0.5519 0.9759 1.0740 0.7520 E
67 IGAAVAGLY 0.1224 0.5195 0.9227 2.6680 0.7914 E
86 NSSITLSGY 0.4554 1.9337 0.9054 2.9490 2.2169 E
123 GISDTPTYY 0.2760 1.1717 0.9695 2.8400 1.4591 E
124 ISDTPTYYW 0.1717 0.7292 0.9710 0.7420 0.9119 E
185 QTDRLAQIH 0.3257 1.3827 0.0494 -0.6190 1.3591 E
223 LASLRYTHY 0.3768 1.5998 0.9733 3.0130 1.8964 E
236 GSDTRFDNL 0.1666 0.7074 0.5364 0.6500 0.8204 E
243 NLTTRFSTY 0.2646 1.1235 0.9764 2.8060 1.4102 E
287 MRGYYQGRY 0.1106 0.4697 0.8758 3.1470 0.7584 E
299 NLISSQLEY 0.2442 1.0368 0.8816 3.1820 1.3281 E
338 WLPTVGVGY 0.1721 0.7306 0.9753 3.0340 1.0286 E

E: Epitope; MHC: Major histocompatibility complex.

Molecular docking and validation

Among the twelve predicted CTL epitopes, six, QIDEWLGHL (BTP-01), GISDTPTYY (BTP-02), ISDTPTYYW (BTP-03), QTDRLAQIH (BTP-04), GSDTRFDNL (BTP-05), and MRGYYQGRY (BTP-06) were identified as candidates capable of eliciting both humoral and cell-mediated immunity, as they were also predicted to be B-cell epitopes. These peptides showed strong binding affinity to the MHC molecule (PDB:5HZH), supported by multiple bonding interactions. Figure 3 shows the detailed 3D and 2D interactions between the six peptides and the fish MHC molecule. All six peptides that underwent molecular docking with the MHC molecule exhibited good docking with relevant free binding energy [Table 3].

Two-dimensional (2D) and three-dimensional (3D) docking results for outer membrane protein BamA peptides of Edwardsiella tarda with the fish major histocompatibility complex (MHC) molecule. (a) QIDEWLGHL–MHC, (b) GISDTPTYY–MHC, (c) ISDTPTYYW–MHC, (d) QTDRLAQIH–MHC, (e) GSDTRFDNL–MHC, and (f) MRGYYQGRY–MHC.
Figure 3:
Two-dimensional (2D) and three-dimensional (3D) docking results for outer membrane protein BamA peptides of Edwardsiella tarda with the fish major histocompatibility complex (MHC) molecule. (a) QIDEWLGHL–MHC, (b) GISDTPTYY–MHC, (c) ISDTPTYYW–MHC, (d) QTDRLAQIH–MHC, (e) GSDTRFDNL–MHC, and (f) MRGYYQGRY–MHC.
Table 3: Interactions between OMP- BamA peptides of E. tarda and the fish major histocompatibility complex (MHC) molecule
Sl. No. Complex Peptide code Free binding energy/affinity (kcal/mol) Hydrogen bonds
1 QIDEWLGHL-MHC (BTP-01) -8.6956 10
2 GISDTPTYY-MHC (BTP-02) -8.0592 11
3 ISDTPTYYW-MHC (BTP-03) -8.1317 10
4 QTDRLAQIH-MHC (BTP-04) -7.1180 8
5 GSDTRFDNL-MHC (BTP-05) -7.9803 16
6 MRGYYQGRY-MHC (BTP-06) -7.6080 10

Source of MHC molecule: Grass Carp (Ctenopharyngodon idella) (PDB: 5H5Z).

Immune simulation

The C-ImmSim web server, which provides the immunological profiles of the target vaccine, was used for the simulation study. The antibody titres of IgM and IgG were significantly high, with production beginning around the fifth day post-immunization [Supplementary Figure S1A]. Alongside the antibodies, there was a significant increase in cytokines and interleukins such as IFN-γ, TGF-β, IL-2, IL-10, and IL-12, with the highest increase observed in IFN-γ [Supplementary Figure S1B].

Supplementary Figure S1

DISCUSSION

Developing efficient and safe vaccines remains crucial for preventing and controlling infectious diseases, playing an important role in global health management. Advances in recombinant DNA technology and immunoinformatics have enhanced our ability to identify and validate promising antigens. Among potential targets in bacterial diseases, OMPs are generally strong vaccine candidates because their surface-exposed epitopes make them highly immunogenic. The host immune system can easily recognise regions of these proteins as foreign, facilitating the generation of an immune response.[24] Multiple studies have targeted bacterial OMPs as vaccine candidates in various pathogens.

Conducting in silico analysis prior to experimental production of subunit vaccines is essential, as it allows the rational identification, screening, and evaluation of potential antigen targets. Such computational approaches help narrow down the most promising candidates, thereby saving time, reducing costs, and increasing the efficiency of subsequent laboratory validation. This study aimed to evaluate the potential of BamA as a vaccine candidate through a comprehensive in silico approach integrating structural analysis and immunoinformatics.

The target protein was confirmed to have a β-barrel transmembrane structure. OMPs are of particular interest in vaccine design, as effective immune recognition generally requires the antigen to either be secreted, surface-exposed, or embedded in the outer membrane of the organism.[25,26]

Analysis of the signal peptide and sub-cellular localization predicts the protein to be localised in the outer membrane, supporting its accessibility to the host immune system and interaction with immunostimulatory molecules.

A three-dimensional homology model was also generated for BamA, providing insights into the structure and potential biological function of the protein. The selection of the template model is justified by the species and sequence similarity to the target protein. The quality of the model, as indicated by the GMQE and QMEAN scores, was within the acceptable range reported for reliable models. The model predicted a β-barrel structure, typical of the OMPs in Gram-negative bacteria. Validation analysis further strengthened the reliability of the predicted model. The Ramachandran plot assessment demonstrated that the majority of the residues were positioned within favoured regions. The Z-score obtained by ProSA also indicated that the predicted model was well within the range of experimentally determined structures.

Surface-exposed proteins, particularly those located on the outer membrane, are widely recognised as efficient vaccine candidates due to their accessibility to the host immune system. Supporting this, the adhesin probability score for BamA, as determined by Vaxign2, was 0.573, indicating its likelihood of functioning as an adhesin. Furthermore, 13 sites on the protein were predicted to be antigenic.

Since recognizing B-cell epitopes stimulates antibody production, their identification is critical for designing and optimizing pathogen-specific vaccines. This study predicted the target protein to have 14 B-cell epitopes of varying lengths, suggesting their potential to generate an antibody-mediated immune response. Cytotoxic T-lymphocyte (CTL) epitopes were predicted using the NetCTL 1.2 server, which integrates prediction of MHC binding affinity, proteasomal C-terminal cleavage, and TAP transport affinity.[17] Twelve T-cell epitopes were predicted in BamA. Notably, six of these overlapped with B-cell epitopes, indicating that these regions could induce both the humoral and cell-mediated immune response. These six common epitopes were further used for docking studies. In these studies, the binding of the common epitopes was evaluated with the MHC molecule of bony fishes. Among the six epitopes, BTP-01 and BTP-03 showed the best docking with the lowest binding energy.

The C-ImmSim simulation indicated that the target protein can induce a strong immune response. The early rise of IgM and IgG from day 5 suggests effective B-cell activation. The simultaneous increase in cytokines such as IFN-γ, IL-2, IL-10, IL-12, and TGF-β reflects activation of both humoral and cell-mediated immunity. Notably, the strong IFN-γ response indicates a Th-1-inclined profile, which is beneficial for intracellular pathogens like E. tarda. Overall, the simulation predicts that the vaccine construct can generate a good protective immune response, validating it for further experiments.

A comparable in silico strategy was previously employed to evaluate BamA as a vaccine candidate for E. coli (colibacillosis) in mice, followed by in vivo validation, which resulted in an 80% survival rate relative to the control group.[27] BamA exhibited high sequence conservation, lacked allergenic properties, demonstrated strong immunogenic responses in mice, and promoted enhanced opsonophagocytic activity, highlighting its potential as a subunit vaccine antigen. Recombinant BamA of A. baumannii elicited strong opsonizing antibody responses and provided significant protection in a murine pneumonia model. The vaccine reduced bacterial load and inflammation, highlighting BamA as a promising candidate against multidrug-resistant A. baumannii infections.[28]

These studies underscore the translational value of BamA as a broadly immunogenic protein and potential vaccine candidate against E. tarda.

Considering our findings, the structural predictions, antigenicity assessments, and epitope identification and binding strongly support BamA as a promising vaccine candidate against Edwardsiella. Its predicted surface accessibility, presence of multiple B and T cell epitopes, and demonstrated potential to engage both humoral and cell-mediated immune responses provide a good rationale for further exploration. Comparative studies in other pathogens have also validated BamA as an effective antigen. Experimental validation in vivo would be the next crucial step. Additionally, proteomics and transcriptomic approaches can be considered to identify surface proteins involved in host-pathogen interaction. Computational tools reduce the time and cost associated with traditional trial and error vaccine development and enhance the likelihood of success by ensuring that only the most promising vaccine candidates are taken forward to laboratory validation.

CONCLUSION

Although reverse vaccinology has made a significant contribution to human and veterinary vaccines, its application in fish vaccinology remains relatively underexplored. Using in silico analyses provides an efficient and rational strategy for subunit vaccine discovery, enabling antigen identification, screening, and confirmation before labour and cost-intensive laboratory trials. The in silico analyses conducted in this study strongly highlight BamA as a potential vaccine candidate against edwardsiellosis, emphasising the importance of computational approaches in rationalising and strengthening vaccine development. These findings demonstrate the global significance of immunoinformatics in addressing infectious diseases across species and ecosystems, paving the way for sustainable and data-driven solutions to global health challenges.

Acknowledgment

This study was supported by the Department of Science and Technology (DST), Government of India, through the Indo-Norway joint project (INT/NOR/RCN/BIO/P-01/2018). The authors acknowledge the support provided by the Department of IT, BT, and S & T, Govt. of Karnataka, in establishing the Centre of Excellence in Aquamarine Innovation at the institute for providing the resources and infrastructure for aquaculture research.

Ethical approval

The study, approved by the Central Ethics Committee at NITTE (Deemed to be University), number NU/CEC/2021/153, dated 21st August 2021.

Declaration of patient consent

Patient’s consent not required as there are no patients in this study.

Financial support and sponsorship

This study was supported by the Department of Science and Technology (DST), Government of India, through the Indo-Norway joint project, grant number INT/NOR/RCN/ BIO/P-01/2018.

Conflicts of interest

There are no conflicts of interest.

Use of artificial intelligence (AI)-assisted technology for manuscript preparation

The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using AI.

References

  1. , , , , , , et al. Development of oral vaccine using calcium phosphate nanoparticles conjugated with outer membrane protein of Aeromonas hydrophila in Oreochromis niloticus (Tilapia) Vaccine. 2025;62:127508.
    [CrossRef] [PubMed] [Google Scholar]
  2. , , , , . Analysis of alternative splicing and long noncoding RNAs after the Edwardsiella anguillarum infected the immunized European eels (Anguilla anguilla) revealed the role of outer membrane protein A in OmpA subunit vaccine. Mar Biotechnol (NY). 2023;25:372-87.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  3. , , . Biotechnological advances in the development of outer membrane protein-based vaccines for use in aquaculture. In: Biotechnological advances in aquaculture health management Biotechnological advances in aquaculture health management. Springer Nature Singapore; . p. :43-59.
    [Google Scholar]
  4. , , , . Utilizing outer membrane proteins (OMPs) as a vaccine to manage motile Aeromonas septicemia (MAS) in Nile tilapia (Oreochromis niloticus) with evaluating the vaccine immunoprotective effectiveness. Aquacult Int. 2024;32:7235-52.
    [CrossRef] [Google Scholar]
  5. , , , , , , et al. Immunization of a novel outer membrane protein from Aeromonas hydrophila simultaneously resisting a. hydrophila and Edwardsiella anguillarum infection in European eels (Angullia angullia) Fish Shellfish Immunol. 2020;97:300-12.
    [CrossRef] [PubMed] [Google Scholar]
  6. , , , . Drug binding to BamA targets its lateral gate. J Phys Chem B. 2023;127:7509-17.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  7. , . Reverse vaccinology: Developing vaccines in the era of genomics. Immunity. 2010;33:530-41.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  8. , , , , . Recombinant outer membrane protein A (OmpA) of Edwardsiella tarda, a potential vaccine candidate for fish, common carp. Microbiol Res. 2011;167:1-7.
    [CrossRef] [PubMed] [Google Scholar]
  9. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, et al. Short protocols in molecular biology. 5th edition. 2002. Available from: https://www.scirp.org/reference/referencespapers?referenceid=441096. [Last accessed 2025 October 6].
  10. , , , . PRED-TMBB: A Web server for predicting the topology of β-barrel outer membrane proteins. Nucleic Acids Res 2004:W400-04.
    [Google Scholar]
  11. , , , , , , et al. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat Biotechnol. 2022;40:1023-5.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  12. , , , , , , et al. PSORTb v.2.0: Expanded prediction of bacterial protein subcellular localization and insights gained from comparative proteome analysis. Bioinformatics. 2005;21:617-23.
    [CrossRef] [PubMed] [Google Scholar]
  13. , . ProSA-web: Interactive web service for the recognition of errors in three-dimensional structures of proteins. Nucleic Acids Res. 2007;35:W407-10.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  14. . Recognition of errors in three‐dimensional structures of proteins. Proteins. 1993;17:355-62.
    [CrossRef] [PubMed] [Google Scholar]
  15. , . A semi-empirical method for prediction of antigenic determinants on protein antigens. FEBS Lett. 1990;276:172-4.
    [CrossRef] [PubMed] [Google Scholar]
  16. , , , , , . BepiPred‐3.0: Improved B‐cell epitope prediction using protein language models. Protein Sci. 2022;31:e4497.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  17. , , , , , . Large-scale validation of methods for cytotoxic T-lymphocyte epitope prediction. BMC Bioinformatics. 2007;8:424.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  18. , , , , , et al. Open Babel: An open chemical toolbox. J Cheminform. 2011;3:33.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  19. , , , , . AutoDockFR: Advances in protein-ligand docking with explicitly specified binding site flexibility. PLoS Comput Biol. 2015;11:e1004586.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  20. BIOVIA, Dassault Systèmes, Discovery studio, v21.1.0.20298, San Diego: Dassault Systèmes, 2021.
  21. , , , , , . The mechanism of β2m molecule-induced changes in the peptide presentation profile in a bony fish. iScience. 2020;23:101119.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  22. , , , . AutoDock Vina 1.2.0: New docking methods, expanded force field, and python bindings. J Chem Inf Model. 2021;61:3891-8.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  23. , , , . Computational immunology meets bioinformatics: The use of prediction tools for molecular binding in the simulation of the immune system. PLoS One. 2010;5:e9862.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  24. , , , , , , et al. Recombinant Aeromonas hydrophila outer membrane protein 48 (Omp48) induces a protective immune response against Aeromonas hydrophila and Edwardsiella tarda. Res Microbiol. 2012;163:286-91.
    [CrossRef] [PubMed] [Google Scholar]
  25. , , , , , . Outer membrane protein a: An immunogenic protein induces highly protective efficacy against Vibrio ichthyoenteri. Microb Pathog. 2017;113:152-9.
    [CrossRef] [PubMed] [Google Scholar]
  26. , , , , . Computer aided selection of candidate vaccine antigens. Immunome Res. 2010;6 Suppl 2:S1.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  27. , , , , . In silico analysis and recombinant expression of BamA protein as a universal vaccine against Escherichia coli in mice. Appl Microbiol Biotechnol. 2016;100:5089-98.
    [CrossRef] [PubMed] [Google Scholar]
  28. , , . Immunoprotective potential of BamA, the outer membrane protein assembly factor, against MDR Acinetobacter baumannii. Sci Rep. 2017;7:12411.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
Show Sections