Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Brief Report
Case Report
Case Series
Current Issue
Editorial
Erratum
Guest Editorial
Letter to the Editor
Media & News
Narrative Review
Notice of Retraction
Original Article
Original Research
Review Article
Short Communication
Short Communications
Systematic Review and Meta-analysis
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Brief Report
Case Report
Case Series
Current Issue
Editorial
Erratum
Guest Editorial
Letter to the Editor
Media & News
Narrative Review
Notice of Retraction
Original Article
Original Research
Review Article
Short Communication
Short Communications
Systematic Review and Meta-analysis
View/Download PDF

Translate this page into:

Original Article
13 (
04
); 563-567
doi:
10.1055/s-0043-1761258

Misidentification of Plasmodium Species by Cross-Reacting Primers and Cerebral Malaria Caused by Plasmodium vivax

Division of Infectious Diseases, Nitte University Centre for Science Education and Research, Deralakatte, Mangaluru, Karnataka, India
Nitte University Centre for Science Education and Research, Deralakatte, Mangaluru, Karnataka, India
Department of Pathology, K S Hegde Medical Academy, Deralakatte, Mangaluru, Karnataka, India

Address for correspondence Rama Adiga, PhD, Assistant Professor, Division of Infectious Diseases, Nitte University Centre for Science Education and Research, Deralakatte, Mangaluru, 575 018, Karnataka, India (e-mail: rama_adiga@nitte.edu.in)

Licence
This is an open access article published by Thieme under the terms of the Creative Commons Attribution License, permitting unrestricted use, distribution, and reproduction so long as the original work is properly cited. (https://creativecommons.org/licenses/by/4.0/)
Disclaimer:
This article was originally published by Thieme Medical and Scientific Publishers Pvt. Ltd. and was migrated to Scientific Scholar after the change of Publisher.

Abstract

Introduction

The clinical presentation of a case as cerebral malaria with molecular identification confirming it as Plasmodium vivax underlines the importance of using molecular tools to identify the species and type of malaria. The possibility of the relationship between the complication observed during clinical diagnosis and the multifactorial molecular changes could likely be the reason for terming it cerebral malaria.

Methods

We report four cases analyzed using the quantitative buffy coat technique followed by classical Giemsa stained thick-film microscopy, and nested polymerase chain reaction for the genus-specific region of Plasmodium targeting 18S rDNA followed by species-specific identification with a different set of primers and products confirmation with sequencing.

Results

Primers targeting P. knowlesi generated the expected product size of 153 base pairs that, upon sequencing, matched with the P. vivax sequence reflecting the relatedness of the species. Likewise, primers targeting P. ovale generated a 456 product whose sequence matched the P. vivax sequence.

Conclusion

Infection with P. vivax can potentially cause cerebral malaria, and P. vivax can cause severe malaria complications alone or mixed with other species and can show cerebral malaria signs, which are typically associated with P. falciparum infections. The sequence relatedness reflects the genome similarity between P. knowlesi and P. ovale with P. vivax. The need to reconfirm with an additional set of newly reported primers is mandatory.

Keywords

Plasmodium knowlesi
P. falciparum
TFM
QBC
PCR

Introduction

Plasmodium vivax also referred to as “benign tertian malaria” in clinical practice, typically leads to a benign course with few complications.1 The World Health Organization (WHO), in its 2021 World Malaria survey, registered 241 million malaria cases worldwide in 2020, resulting in the death of 627,000 individuals, with 85% of them recorded from 20 countries and India being the only non-African country among them. Furthermore, 53% of P. vivax-related cases have been recorded in the WHO South-East Asia Region, with a high of 47% in India alone and about 82% of all malaria deaths.2 Mangaluru, a city located in the state of Karnataka on the Southwest coast of India, is known for its rivers and tropical climate and is hypoendemic and seasonal to malaria. With the growing industrialization and a vast floating population of migrant workers at various construction sites, the city is prone to vector-borne diseases like malaria, mainly P. falciparum and P. vivax.3 The monsoon season between late May and October coincides with a sharp increase in malaria cases, and the stagnant rainwater provides an ideal breeding ground for mosquitoes.4 More than 50% of the cases reported in Karnataka are from Mangalore alone, 5 with the majority being positive for P. vivax, followed by P. falciparum. Apart from these species, P. malariae, P. ovale, and P. knowlesi, which are also responsible for malaria, are rarely recorded. P. falciparum is known to cause 90% of the world's malarial deaths,6 with 50% of the cases in the South-East Asian region (SEARO of WHO). To date, P. knowlesi has only been recorded in India from the Andaman and Nicobar Islands.7P. vivax is regarded as less severe than P. falciparum malaria. Recent research and case reports, on the other hand, have conclusively proven that P. vivax infection may induce all of the complications associated with severe P. falciparum malaria.8 More recently, reports on multiple infections, drug-resistant parasites, haplotypes within the species or subspecies and newer species of Plasmodium are being recorded. Against this background, molecular techniques become essential to dispel the ambiguity in reporting. Polymerase chain reaction (PCR) for detection followed by gene sequencing can offer the much-needed platform for diagnosis and epidemiology, help administer appropriate drugs, and prevent the spread of drug resistance. Febrile patients, positive for malaria upon microscopic, quantitative buffy coat (QBC) and other rapid diagnostic tests, are treated empirically with antimalarial medications without confirmed detection of species diagnosis. The test relies largely on microscopic analysis of blood smears,9 which can present ambiguous results. Individuals with a low level of parasitemia, as in mild/early infection, can be missed due to difficulty in diagnosis by thick-film microscopy (TFM), QBC or rapid diagnostic test. However, DNA-based molecular test such as PCR facilitates the accurate identification of infection of low density, the species involved, and, more importantly, mixed infections that may be missed by TFM.10 Infection with P. falciparum is most frequently associated with cerebral malaria (CM), leading to renal dysfunction, respiratory distress, and bleeding abnormalities. Also, of concern is the observation that clinical presentation as CM due to P. vivax has recently been reported.1112 Further, some oligonucleotide primers designed previously to amplify the regions in 18S specific to a particular Plasmodium species show cross-reaction by PCR, raising concerns about the diagnosis on species identification made hitherto. The PCR primers reported and commonly used to detect P. knowlesi infections in humans cross-reacted stochastically with P. vivax genomic DNA.13 In this study, we report a case of severe malaria due to P. vivax that was characteristic in its clinical presentation and diagnosed as CM. Additionally, three cases that gave ambiguous results by PCR on the involvement of multiple Plasmodium species when retested with a different set of newly reported primers confirmed false positive reports of P. knowlesi and P. ovale due to overlapping of the primer binding regions with P. vivax. The sequencing of the PCR products confirmed them to be P. vivax.

Materials and Methods

Blood samples from four patients collected during 2017-2019 were confirmed as malaria according to symptoms outlined by National Vector Borne Disease Control Programme (NVBDCP), which included sweating, chills, shock, jaundice, convulsions, pulmonary oedema, and splenomegaly. Consent from these patients who had attended Justice K.S Hegde Charitable Hospital in Mangalore was obtained per the ethical guidelines. The institutional Ethical committee clearance was obtained vide NU/CEC/ICMR-05/2015, NU/CEC/2018/0183.

Hematological Analysis

Thick and thin blood films were prepared and stained for 10 minutes with 10% Giemsa staining solution (pH 7.2) and microscopically examined using the oil immersion objective (100X). At least 200 fields were examined before reporting a sample as negative/no malaria parasites seen. The number of parasites in thick film smears was scored using the plus system scale to indicate the parasite density in the positive cases: + (1–10 parasites per 100 fields); ++ (11–100 parasites per 100 fields); +++ (1–10 parasites per field); ++ + + (>10 parasites per field). Using these scores, the parasite density was estimated in the blood samples: ± 4 to 40 parasites/μL; ++> 40 to 400 parasites/μL; ++ + > 400 to 4,000 parasites/μL; ++ + +> 4,000 parasites/μL, 50 fields were examined under oil immersion objective, and the morphology and numbers of microorganisms and cells per field were recorded.1415 Blood stratification and its components post-centrifugation were used in QBC for parasite detection in the blood for the presence of malarial parasites as follows. Two milliliter of venous blood was collected in a sterile heparinized tube and used for QBC, followed by fluorescent microscopic observation to identify erythrocyte clusters in layers of cells that had the parasite.16

Polymerase Chain Reaction

For PCR amplification, a modification of the method previously reported was employed.17 The speciation of Plasmodium could be confirmed using various species-specific primers. DNA was extracted (DNeasy Blood and Tissue Kit, QIAGEN, Germany) from 200 µL of heparinized blood samples collected from each individual. To improve the sensitivity of specific oligonucleotide primer binding, the nested polymerase chain reaction (nPCR) amplifications were performed in a thermocycler (Eppendorf NexusGX2, Germany).1819 Primers binding to the conserved region in the 18S rDNA located in the small-subunit were used. These primers were employed to identify the Plasmodium genus, and the species identification was by nPCR using the first step product as the template. Each 30 µL reaction mixture includes 2 µL (100 ng/L) DNA template, 0.8 µL (8 8 pM) primers, 3.3 µL 10x buffer, 0.8 µL (110 mM) deoxynucleoside triphosphate, and 0.3µL (1.5 units) Taq DNA polymerase (Himedia Laboratories Pvt. Ltd., India). For quality control, nonmalaria/noninfected blood samples and nontemplate control were used as negative control and blood from malaria cases confirmed by the gold standard microscopy (TFM) and QBC was used as positive control. The reaction mix was initially denaturated at 94°C for 3 minutes, followed by 35 cycles of denaturation at 94°C for 60 seconds, annealing temperature according to the primer sets used for 30 seconds, extension at 72°C for (90 seconds for the primer pair rPLU1/rPLU5 and 60 seconds for all other primers), and final delay at 72°C for 10 minutes. For the first step reaction for the genus Plasmodium, the primer pair rPLU1/rPLU5 was used; for nested reaction, the primer pair rPLU3/rPLU4 was employed for PCR. Species-specific primers were used on the primary amplification product generated using genus-specific primers. Table 1 presents the different primers employed. rFAL1 and rFAL2 was used for P. falciparum; rVIV1 and rVIV2 for P. vivax; rOVA1 and rOVA, rOVA 3, and rOVA4 for P. ovale; rMAL1 and rMAL2 for P. malariae; and pmk8 and pmkr9, Pk1140-Pk1150 for P. knowlesi.1320

Table 1 Oligonucleotide primers used in the study

Primer name

Primer sequence (5′ to 3′)

Target genus/species

Amplicon size (bp)

Annealing temperature

References

rPLU1_F

TCAAAGATTAAGCCATGCAAGTGA

Plasmodium genus

∼1,670

54°C

18

rPLU5_R

CCTGTTGTTGCCTTAAACTTC

rPLU3_F

TTTTTATAAGGATAACTACGGAAAAGCTGT

Plasmodium

genus

240

52°C

18

rPLU4_R

TACCCGTCATAGCCATGTTAGGCCAATACC

rFAL1_F

TTAAACTGGTTTGGGAAAACCAAATATATT

P. falciparum

205

60°C

18

rFAL2_R

ACACAATGAACTCAATCATGACTACCCGTC

rVIV1_F

CGCTTCTAGCTTAATCCACATAACTGATAC

P. vivax

121

55°C

18

rVIV2_R

ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA

rMAL1_F

ATAACATAGTTGTACGTTAAGAATAACCGC

P. malariae

145

53.5°C

18

rMAL2_R

AAAATTCCCATGCATAAAAAATTATACAAA

rOVA3_F

CGGGGAAATTTCTTAGATTGC

P. ovale

456

50°C

21

rOVA4_R

GAGAAACAGCATGAATTGCG

Pmk8

GTTAGCGAGAGCCACAAAAAAGCGAAT

P. knowlesi

153

60°C

21

Pmkr9

ACTCAAAGTAACAAAATCTTCCGTA

rOVA1_F

ATCTCTTTTGCTATTTTTTAGTATTGGAGA

P. ovale

787

58°C

18

rOVA2_R

GGAAAAGGACACATTAATTGTATCCTAGTG

PkF1140

GATTCATCTATTAAAAATTTGCTTC

P. knowlesi

410

50 °C

12

PkR1550

TCTTTTCTCTCCGGAGATTAGAACTC

Sequencing Analysis

The PCR products amplified were extracted and purified using Gel extraction kit (QIAquick Gel Extraction Kit, QIAGEN, Germany); the extracted DNA was quantified by nanodrop (NanoPhotometer, IMPLEN) and both forward and reverse direction of the products were outsourced for Sanger sequencing at Eurofins Genomics India Pvt Ltd., Bangalore, Karnataka, India.

Results and Discussion

In the first case, the clinical diagnosis made by the physician as CM was based on the cardinal signs and symptoms of the condition. However, the laboratory diagnosis was based on TFM, and it was identified as P. vivax by observing the trophozoites and gametocyte stages. QBC was used to confirm Plasmodium vivax trophozoite and gametocyte. PCR was performed using primers for all plasmodial species to confirm further using the molecular method on the causative parasite. A single band with the product size for P. vivax was obtained. Thrombocytopenia and microcytic hypochromic anemia were also observed. It is well-known that CM caused by P. falciparum is a severe neurological disease caused by P. falciparum, where recovered individuals are prone to epilepsy, cognitive degradation, and other neurological complications and long-term brain impairments. The parasite can enter an asexual form remaining in the blood smears, causing the patient to sometimes even enter into a coma.22 In this case, however, P. vivax was detected and confirmed as the cause of CM. In a previous study by Kochar et al and others1123242526 it was found that P. vivax was reported as the causative agent of CM and mechanisms, such as sequestration wherein the erythrocytes with trophozoites or schizonts attach to the endothelium of blood vessels, which is commonly associated with P. falciparum infection that was observed.27 Case 2 was recorded as a mixed infection caused by several species. By TFM, trophozoites and gametocytes of P. vivax were observed along with P. falciparum. The results corroborated the observation by QBC. PCR results were contrary to the above. Test for P. vivax (rVIV1 and rVIV2), P. falciparum (rFAL1 and rFAL2), P. ovale (rOVA 3 and rOVA4), P. malariae (rMAL1 and rMAL2), and P. knowlesi (pmk8 and pmkr9) generated bands with all the sets of primers used except for P. malariae. However, it was concluded that these primers had shown cross-reaction with the primers for P. knowlesi and P. ovale. These primers were found to bind to the regions similar to the P. vivax primer in their binding to the target; hence, bands were generated, leading to false interpretation. To address this misidentification of Plasmodium species, a pair of primer sets published recently were used for P. knowlesi, Pk1140 and Pk1150 (Table 2).13 It is significant to note that it yielded no bands for P. knowlesi. Similarly, reconfirmation of P. ovale using a new set of primers rOVA1 and rOVA2 did not generate any PCR product; it could therefore be concluded that cross-reaction of the species-specific primers in the identification of the Plasmodium species was a severe issue in the identification of species. To reconfirm, the primers rPLU1 and rPLU5 were used for primary amplification, followed by nested reaction with secondary primer pair rPLU3 and rPLU4 for genus-specificity. Species-specific bands for P. vivax and P. falciparum were obtained during reconfirmation, proving that this was a mixed infection by P. vivax and P. falciparum.

Table 2 Species confirmation using different primer sets

Cases

Thick-film microscopy (TFM) with a grade of parasitemia

Quantitative buffy coat analysis

Polymerase chain reaction (PCR)

PCR reconfirmation using a different set of primers

Case 1

PVTG (+)

PVTG (CM)

PV

PV

Case 2

PVTG (++) PF (+)

PV & PF

PV +PF + PK + PO

PV + PF

Case 3

PVTG (+++)

PVTG

PV + PO + PK

PV

Case 4

PVTG (++)

PVTG

PV + PO + PK

PV

Abbreviations: CM, cerebral malaria; PF, Plasmodium falciparum; PK, Plasmodium knowlesi; PO, Plasmodium ovale; PV, Plasmodium vivax; PVTG, Plasmodium vivax trophozoites and gametocytes.

In cases 3 and 4, trophozoites and gametocytes of P. vivax were detected by TFM and QBC in the erythrocytes. The infection was of high grade. PCR was performed using species-specific primers. The results showed positive for P. vivax, P. ovale, and P. knowlesi. On reconfirming PCR using the new primers, it revealed cross-reaction leading to false positive results for P. ovale and P. knowlesi (Table 2). There was a single band for P. vivax in both cases, with the updated primers confirming that the infection was indeed due to P. vivax.

Although P. falciparum has been exclusively associated with the causative agent of CM, recent studies have shown the involvement of P. vivax with the reported complications, as recorded in case 1.28P. vivax is known to have part of the variant surface antigen known as variant interspersed repeat (vir) genes. These vir genes are extremely vital in the virulence and pathogenicity of P. vivax as it is involved in antigenic variation, which helps the Plasmodium parasite evade the host immune cells.29 Studies have shown that the role of these genes in P. vivax and P. falciparum in a mixed infection can be deadly if they go undetected and not treated appropriately.30 In conclusion, it is pertinent to note that the bands generated with the initial set of primers for all the species of Plasmodium were due to primer cross-reaction or primer cross-hybridization with shared binding regions leading to the false positive reaction following PCR.13 This leads to positive bands suggesting a particular Plasmodium species when it is merely a mutation of the parasite in the samples, making them available for primer binding. The primer initially published131831 has been widely used for diagnosis, but in recent times these primers are increasingly generating bands due to false positive reactions.32 It is hypothesized that this recent surge could be due to the increase in mixed infections and the rise of malaria in Mangalore and the Dakshina Kannada region. This, in turn, leads the newer Plasmodium population to mutate and evolve, causing the older primers to be less effective in correctly identifying the species.33 As seen in this case (Table 2), the P. knowlesi primers Pmkr8 and Pmkr9 cross-reacted with human DNA sequences, thus generating a false positive band.734

Acknowledgements

We are grateful to Nitte University Centre for Science Education & Research and Nitte (Deemed to be University) for providing a Research environment and facility for carrying out the study.

Conflict of Interest

None declared.

Conflict of Interest

None declared.

Funding The authors are grateful to Nitte (Deemed to be University) for providing the required financial support for the study through the Nitte University Research grant (NUFR2/2018/10/26).

References

  1. , . How benign is benign tertian malaria? J Vector Borne Dis. 2009;46(02):141-144.
    [Google Scholar]
  2. . World Malaria Report Geneva: World Health Organization; .
    [Google Scholar]
  3. . National Vector Borne Disease Control Programme. 2022 Accessed January 8, 2023, at:
    [Publisher] [Google Scholar]
  4. , , , et al.. Manifestation of malaria in Mangaluru, southern India. Malar J. 2018;17(01):313.
    [Google Scholar]
  5. . Global malaria eradication and the importance of Plasmodium falciparum epidemiology in Africa. BMC Med. 2015;13(01):23.
    [Google Scholar]
  6. , , , et al.. Malaria Severity in Mangaluru City in the Southwestern Coastal Region of India. Am J Trop Med Hyg. 2019;100(02):275-279.
    [Google Scholar]
  7. , , , . Anopheles sundaicus Mosquitoes as Vector for Plasmodium knowlesi, Andaman and Nicobar Islands, India. Emerg Infect Dis. 2019;25(04):817-820.
    [Google Scholar]
  8. , , , , , . Complications associated with Plasmodium vivax malaria: a retrospective study from a tertiary care hospital based in Western Uttar Pradesh, India. Ann Afr Med. 2013;12(03):155-159.
    [Google Scholar]
  9. , , , , . A rare case of quadruple malaria infection from the highly malaria-endemic area of Bastar, Chhattisgarh, India. PLoS Negl Trop Dis. 2017;11(07):e0005558.
    [Google Scholar]
  10. , , , et al.. Comparison of three diagnostic methods (microscopy, RDT, and PCR) for the detection of malaria parasites in representative samples from Equatorial Guinea. Malar J. 2018;17(01):333.
    [Google Scholar]
  11. , , . Spectrum of complications associated with Plasmodium vivax infection in a tertiary hospital in South-Western India. Asian Pac J Trop Med. 2012;5(01):79-82.
    [Google Scholar]
  12. . Plasmodium vivax cerebral malaria - a rare cause of multi organ dysfunction. J Anesth Crit Care. 2015;3(03):3-5.
    [Google Scholar]
  13. , , , , , . Spurious amplification of a Plasmodium vivax small-subunit RNA gene by use of primers currently used to detect P. knowlesi. J Clin Microbiol. 2009;47(12):4173-4175.
    [Google Scholar]
  14. , . Complicated malaria symptoms associated with Plasmodium vivax among patients visiting health facilities in Mendi town, Northwest Ethiopia. BMC Infect Dis. 2016;16(01):436.
    [Google Scholar]
  15. . Basic Malaria Microscopy – Part II: Tutor's Guide 2nd ed. Geneva, 2010:53 p
    [Google Scholar]
  16. , . Quantitative buffy coat analysis-an effective tool for diagnosing blood parasites. J Clin Diagn Res. 2014;8(04):DH01.
    [Google Scholar]
  17. , . Nested PCR analysis of Plasmodium parasites. Methods Mol Med. 2002;72:189-203.
    [Google Scholar]
  18. , , , , , . A genus- and species-specific nested polymerase chain reaction malaria detection assay for epidemiologic studies. Am J Trop Med Hyg. 1999;60(04):687-692.
    [Google Scholar]
  19. , , , et al.. High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Mol Biochem Parasitol. 1993;61(02):315-320.
    [Google Scholar]
  20. , , . Detection of Plasmodium using filter paper and nested PCR for patients with malaria in Sanliurfa, in Turkey. Malar J. 2016;15(01):299.
    [Google Scholar]
  21. , , , , , . Comparison of blood smear, antigen detection, and nested-PCR methods for screening refugees from regions where malaria is endemic after a malaria outbreak in Quebec, Canada. J Clin Microbiol. 2004;42(06):2694-2700.
    [Google Scholar]
  22. , , , . Cerebral malaria: mechanisms of brain injury and strategies for improved neurocognitive outcome. Pediatr Res. 2010;68(04):267-274.
    [Google Scholar]
  23. , , , , , . Plasmodium vivax malaria. Emerg Infect Dis. 2005;11(01):132-134.
    [Google Scholar]
  24. , , , et al.. Plasmodium vivax and mixed infections are associated with severe malaria in children: a prospective cohort study from Papua New Guinea. PLoS Med. 2008;5(06):e127.
    [Google Scholar]
  25. . Neglect of Plasmodium vivax malaria. Trends Parasitol. 2007;23(11):533-539.
    [Google Scholar]
  26. , , , . Plasmodium vivax malaria: is it actually benign? J Infect Public Health. 2011;4(02):91-95.
    [Google Scholar]
  27. , , , , . Parasite sequestration in Plasmodium falciparum malaria: spleen and antibody modulation of cytoadherence of infected erythrocytes. Proc Natl Acad Sci U S A. 1983;80(16):5075-5079.
    [Google Scholar]
  28. , , , . Severe malaria due to Plasmodium vivax: case report. Current Pediatric Research. 2016;20((1–2):):24-28.
    [Google Scholar]
  29. , , , , . Assessing the genetic diversity of the vir genes in Indian Plasmodium vivax population. Acta Trop. 2012;124(02):133-139.
    [Google Scholar]
  30. , , , . Genetic polymorphisms in VIR genes among Indian Plasmodium vivax populations. Korean J Parasitol. 2014;52(05):557-564.
    [Google Scholar]
  31. , , , et al.. A large focus of naturally acquired Plasmodium knowlesi infections in human beings. Lancet. 2004;363((9414):):1017-1024.
    [Google Scholar]
  32. , , , et al.. First case of detection of Plasmodium knowlesi in Spain by Real Time PCR in a traveller from Southeast Asia. Malar J. 2010;9(01):219.
    [Google Scholar]
  33. , , , . Diagnostic difficulties with Plasmodium knowlesi infection in humans. Emerg Infect Dis. 2010;16(06):1033-1034.
    [Google Scholar]
  34. , , , , , . Nested multiplex PCR for identification and detection of human Plasmodium species including Plasmodium knowlesi. Asian Pac J Trop Med. 2017;10(03):299-304.
    [Google Scholar]
Show Sections