Translate this page into:
Novel Class 1 Integron in Clinical Isolates of Burkholderia cepacia Complex
*Corresponding author: Dr. Vijaya Kumar Deekshit, Department of Infectious Diseases and Microbial Genomics, Nitte University Centre for Science Education and Research, Paneer Campus, NITTE (Deemed to be University), Deralakatte, Mangaluru, Karnataka, India. deekshit1486@nitte.edu.in
-
Received: ,
Accepted: ,
How to cite this article: Shetty VP, Shravya R, Rohit A, Deekshit VK. Novel Class 1 Integron in Clinical Isolates of Burkholderia cepacia Complex. J Health Allied Sci NU. 2025;15:542-7. doi: 10.25259/JHS-2024-10-4-R1-(1604)
Abstract
Objectives
The potent nosocomial pathogens, Burkholderia cepacia complex (BCC), comprise a group of diverse, metabolically active bacteria that cause infections in patients with cystic fibrosis (CF) and chronic granulomatous disease (CGD). They have been identified as the leading cause of bacteraemia and sepsis in patients with CF and non-CF. The primary challenge in treating Burkholderia cepacia is its intrinsic resistance to multiple antibiotics, forming a baseline resistance profile. This study aimed to investigate integron-associated acquired resistance mechanisms in selected clinical Burkholderia isolates.
Material and Methods
Clinical Burkholderia cepacia isolates were tested for antimicrobial susceptibility and screened for integrons using the polymerase chain reaction (PCR). The integron-positive isolates were further Sanger sequenced to detect the presence of antimicrobial resistance genes within the cassettes.
Result
The Burkholderia cepacia isolates tested according to the CLSI guidelines showed the highest resistance to amoxicillin-clavulanic Acid (85%). Based on the susceptibility patterns, 55 multidrug-resistant (MDR) isolates were further screened for integrons. Although the prevalence was low, 14 isolates showed the presence of integrons during PCR amplification. Sanger sequencing revealed that one isolate, B6981, carried an integrase and two antibiotic resistance genes (ARGs): dihydrofolate reductase (dfrA5) and erythromycin esterase (ereA2), which code for trimethoprim and erythromycin resistance, respectively. The other isolate, B591, harboured only the integrase gene. The sequencing results were correlated with the phenotypic results.
Conclusion
Although a majority of Burkholderia isolates were found to be multidrug-resistant, the study highlights the low prevalence of integrons among these isolates, suggesting the presence of other resistance mechanisms.
Keywords
Burkholderia cepacia complex
Class 1 integron
Integrons
Multi drug resistance
Mobile genetic elements
INTRODUCTION
Burkholderia cepacia complex (BCC) is an opportunistic, nosocomial pathogen that causes significant disruption in immunocompromised individuals. They comprise nine genomovars and collectively form BCC, representing a group of 24 different species.[1] These bacteria are highly host-specific and are present in soil, water, and plants. Metabolically diverse, they are linked to a varying clinical course in patients with cystic fibrosis (CF). This can include septicaemia, which is associated with a high mortality rate, necrotising pneumonia, and severe lung infections, collectively termed ‘cepacia syndrome’.[2,3] It is one of the prime causes of sepsis in patients with non-CF in India, as it is observed to have a higher incidence (77%) in environmental samples.[4] Originally identified by W. H. Burkholder as a plant pathogen that caused onion rot in the 1950s, it was later identified to cause human infection. The pathogen was initially known by the name Pseudomonas cepacia until 1992, when Yabuuchi and colleagues investigated and replaced it with the new genus Burkholderia.[5] The transmission of B. cepacia complex in both healthcare and non-healthcare settings occurs through direct and indirect contact with infectious secretions and droplets.[6] Due to various resistance mechanisms, BCC infections are resistant to major antibiotics, limiting treatment options.[6] They are intrinsically resistant to polymyxins and aminoglycosides, which is mediated by efflux pump activity.[7] Although first-line treatments for BCC infections include trimethoprim-sulfamethoxazole (TMP-SMX) and ceftazidime, considerable rates of resistance have been observed to these agents as well.[8-10] The emergence of widespread antibiotic resistance has increased the rates of morbidity and mortality associated with serious infections caused by these organisms.
One such root cause of acquired resistance is the horizontal gene transfer (HGT) of the antibiotic resistance genes (ARGs).[6] Mobile genetic elements (MGEs) are pivotal in carrying ARGs from one bacterium to another. They play a crucial role in the persistence and dissemination of antibiotic resistance in most bacteria.[6,11] Integrons, among them, are DNA elements that capture open reading frames inserted in external gene cassettes and transform them into functional genes by ensuring proper expression.[6,11] They are most widely recognised for their ability to spread ARGs across pathogens. Due to their potential to rapidly transmit resistance phenotypes, it is crucial to investigate whether integron-mediated features may impact human health in the future, such as enhanced virulence, pathogenicity, or resistance to emerging antimicrobial treatments in pathogens like Burkholderia. Against this background, our study aimed to screen clinical Burkholderia cepacia isolates from non-CF samples for integrons and to investigate the presence of ARGs within the gene cassettes.
MATERIAL AND METHODS
Bacterial isolates
Burkholderia cultures (60) were revived from the Institutional Repository (Nitte University Centre for Science Education and Research (NUCSER), Mangaluru, India), which were stored at -80°C (Panasonic, Japan). Dr. Anusha Rohit generously provided these isolates from the Madras Medical Mission (Chennai, India). The isolates were grown at 37°C in Luria Bertani broth (LB) (HiMedia Mumbai, India), and the overnight-grown cultures were streaked onto Burkholderia cepacia selective agar (BCSA) (HiMedia, Mumbai, India) and incubated for 48 hours at 37°C.
Antimicrobial susceptibility testing
The antimicrobial susceptibility of the 46 isolates has been published in a previous study by Modapathi et al.[4] The remaining 14 isolates were tested for their antimicrobial susceptibility based on the CLSI guidelines (33rd Edition)[12] against 10 antibiotics: amoxicillin-clavulanic acid (30 µg), ampicillin (25 µg), chloramphenicol (30 µg), ceftazidime (30 µg), co-trimoxazole (25 µg), piperacillin (100 µg), norfloxacin (10 µg), minocycline (30 µg), meropenem (10 µg), and clindamycin (30 µg), using the Kirby Bauer Disk diffusion assay. Burkholderia cultures were revived from -80°C storage. These cultures were then inoculated into the Mueller-Hinton (MH) Broth and incubated until the culture reached 0.5 MacFarland turbidity. The cultures were then swabbed on MH agar plates, and the antibiotic discs were placed over the swabbed culture plates once dried. The plates were incubated at 37°C for 18 hours to observe the zone of inhibition. Results were interpreted by comparing them with Clinical and Laboratory Standards Institute guidelines (33rd edition).[12] The ATCC 25416 culture was used as a quality control strain.
Integron detection by PCR
Clinical isolates that exhibited resistance to at least three antibiotic classes were classified as MDR isolates and were selected for integron gene amplification using the polymerase chain reaction (PCR) technique [Table 1]. For DNA preparation, 1.5 mL of the culture was centrifuged at 10,000 rpm for 10 minutes, 150-200 µL of TE buffer was added to resuspend the pellet, and the tubes were heated at 95°C for 5 minutes to lyse the cells. Following this, the tubes were placed on ice for 10 minutes, centrifuged at 7000 rpm for 3 minutes, and the supernatant was stored for further use. The isolates were screened for both the integrase region and the entire integron of class 1, as well as the integron regions of classes 2 and 3. For PCR, the reaction mixture of 30 µL was prepared, which contained 3 μL of 10X buffer, 10 pmol each of the forward and reverse primers, 200 μM concentrations of each of the deoxyribonucleotide triphosphates, 1.0 U of Taq DNA polymerase (TaKara Bio, Japan), and 2.0 μL of the template. PCR was performed in a thermal cycler (BioRad, CA, USA) with the following cycling conditions: initial denaturation at 95°C, followed by 34 cycles of denaturation at 95°C for 30 seconds, annealing at 63°C, extension at 72°C, and a final extension at 72°C for 10 minutes. The products of PCR were resolved on a 1.5% agarose gel, stained with ethidium bromide, and visualised using the Gel Documentation system (BioRad, CA, USA).
| Gene | Primer sequence | Annealing temperature (°C) | Product size(bp) | Reference |
|---|---|---|---|---|
| IntI 1 (integrase) |
F-TCTCGGGTAACATCAAGG R-AGGAGATCCGAAGACCTC |
63 | 254 | Ahangarkani et al.[27] |
| IntI 2 |
F-CACGGATAAGCGACAAAAAGG R- TGTAGCAAACGAGTGACGAAATG |
63 | 788 | Rizk et al.[28] |
| IntI 3 |
F- AGTGGGTGGCGAATGAGTG R- TGTTCTTGTATCGGCAGGTG |
63 | 600 | |
| IntI 1 |
F- GGCATCCAAGCACCAAGC R- AAGCAGACTTGACCTGAT |
63 | ≥1000 | Deekshit et al.[29] |
bp: Base pairs.
Sanger sequencing and analysis
Out of 55 MDR isolates, 14 bacterial isolates exhibiting the presence of different classes of integrons were subjected to Sanger sequencing. The integron-specific PCR products were subjected to Sanger sequencing. The results of sequencing were analysed using the Basic Local Alignment Search Tool (BLAST) of the National Center for Biotechnology Information NCBI (BLAST: Basic Local Alignment Search Tool (nih.gov)). The sequence was further aligned and compared using the Multalin interface page (INRA, http://multalin.toulouse.inra.fr/multalin/).
RESULTS
Antimicrobial susceptibility testing
Fourteen isolates tested showed the highest resistance to amoxicillin-clavulanic Acid (85%), followed by ampicillin (71%), chloramphenicol (57%), ceftazidime and co-trimoxazole (28%), piperacillin (21%), norfloxacin (7.1%), and minocycline (7%) [Figure 1]. No resistance was found against meropenem and clindamycin. Among the 14 isolates tested in this study, B6981, B591, B917, B2164, B5348, B13158/59, and B5505 exhibited resistance to four antibiotics out of the 10 tested, which was the highest count, and were considered MDR isolates. These 14 MDR isolates were further used to screen integrons in addition to the 41 MDR isolates from the previous study (n=55).

- Graph depicting antibiotic resistance pattern of the 14 isolates against different antibiotics. MI: Minocycline, NX: Norfloxacin, PI: Piperacillin, COT: Co-trimoxazole, CAZ: Ceftazidime, C: Chloramphenicol, AMP: Ampicillin, AMC: Amoxicillin and clavulanic acid.
Screening of integrons
All 55 MDR isolates were screened for integrons using integron-specific primers [Table 1]. Out of 55 isolates, three showed the presence of class 1 integrase only, 10 isolates showed the presence of class 1 integron, and only 1 isolate contained class 2 integrons. None of the isolates exhibited a class 3 integron.
Sequencing
The isolate B6981 was positive for a class 1 integron that carried an integrase gene and two ARGs: dihydrofolate reductase (dfrA5) and erythromycin esterase (ereA2). coding for trimethoprim and erythromycin, respectively [Figure 2]. Isolate B591 contained the integrase gene within its gene cassette. These three sequences were submitted to NCBI GenBank with the accession numbers PQ052888, PQ052889, and PQ166740. The remaining isolates yielded non-specific amplification, indicating the presence of OMP genes and a hypothetical protein. Hence, we considered them integron-negative.

- Class 1 integron map of Burkholderia cepacia isolates (a) B6981 consisting of an integrase gene, dfrA5 gene encoding trimethoprim resistance, and ereA2 gene encoding resistance to erythromycin; (b) B591 consisting of an empty integron with just the integrase gene and without any gene cassette. att I stands for attachment site I.
DISCUSSION
Burkholderia is a potent nosocomial pathogen causing sepsis in non-CF patients with poor clinical outcomes. Over the past few decades, researchers worldwide have conducted epidemiological, taxonomic, and molecular biology studies on BCC strains known to cause persistent infections in CF patients.[13] The intrinsic resistance of BCC isolates to many antibiotics poses a serious global challenge for clinicians treating these infections. The rise of widespread antibiotic resistance has led to higher rates of morbidity and mortality associated with these illnesses. In the current study, the clinical isolates were resistant to most of the antibiotics tested, including ampicillin (71%), chloramphenicol (57%), ceftazidime and co-trimoxazole (28%), piperacillin (21%), norfloxacin (7.1%), and minocycline (7%). Thus, the resistance pattern observed here demands the need for combinational therapy. However, the antibiotic amoxicillin-clavulanic acid used in this study showed maximum resistance (85%), which raises concerns regarding the use of antibiotics in combination therapy. This observation disagrees with the study by Tamma et al.[6] wherein the treatment with another combination, ceftazidime-avibactam, could completely eradicate bacteraemia in a 2-month-old infant. Also, Branstetter et al.[14] revealed that a 17-year-old patient who suffered from CGD and presented with cepacia syndrome could completely recover on the administration of tobramycin, enteral minocycline, ceftazidime, IV sulfamethoxazole-trimethoprim, and corticosteroids. Therefore, understanding the antibiotic susceptibility profiles of organisms is crucial for targeted therapy and effective antimicrobial stewardship.
To delve deeper into the root cause of the above resistance mechanism, our study focused on screening for the presence of integrons within these MDR isolates. Out of the 55 MDR isolates evaluated, integrons were found only within 14 isolates by PCR. However, Sanger sequencing revealed the presence of class 1 integrons only in one isolate, while an integrase gene in another. This depicts decreased prevalence of the integrons among the MDR BCC. Furthermore, the resistance observed in the remaining bacterial isolates could be attributed to alternative mechanisms, including efflux pumps, alterations in metabolic pathways, and genetic mutations. In the present study, among the 14 integron-positive isolates, B6981 and B591 contained a class 1 integron and integrase, respectively. However, none of the isolates carried a class 3 integron by PCR, which highlights the increased prevalence of class 1 integrons. This finding aligns with the study by Zarei-Yazdeli et al.[15], which reported that 82.6% of the Pseudomonas aeruginosa isolates carried intI1 genes, while none of the isolates carried the intI3 gene. Zhang et al.[16] In China, a study revealed the existence of class 1 and class 2 integrons in 252 (81%) and 7 (2.3%) strains, respectively, with the absence of Class 3 integrons.
Currently, in the investigation of the genetic bases of MDR Burkholderia, a significant aspect under consideration is the integron and its associated gene cassettes. These elements play a crucial role in horizontal gene acquisition and gene expression, serving as a gene reservoir, and have been linked to the development of antibiotic resistance among clinical bacterial isolates.[11] Also, there have been numerous studies that have utilised Sanger sequencing as a standard technique for the determination of unknown gene function within the gene cassettes.[17,18] Hence, we examined the presence of the gene cassettes by subjecting the integron-positive isolates to Sanger sequencing.
The gene cassettes investigated in this study belonged to the family of dihydrofolate reductase (dfrA5), which encodes resistance to trimethoprim, and erythromycin esterase (ereA2), which encodes for erythromycin resistance. The nucleotide sequence of the integron revealed 99% and 100% similarity with the sequences from the NCBI GenBank (CP156941.1, CP162903.1). The gene cassette encoding trimethoprim resistance discovered in our study is one of the most common genes integrated within class 1 integrons in the clinical isolates.[19,20] This prevalence may also reflect the selection pressure exerted when these antibiotics were more extensively used in the past.[21-29] However, the presence of the gene encoding for erythromycin resistance belongs to the macrolide family, to which species of BCC are innately resistant.[24-26] Hence, these gene cassettes, even though not commonly found in class 1 integrons, were detected in the current study. The presence of the integrase gene in another isolate, B591, indicates that it can readily accommodate resistance genes through the natural acquisition and dissemination mechanism of the integrons.
The limitation of the present study is that the genes identified within the gene cassette can only support the resistance patterns of trimethoprim as observed in antimicrobial susceptibility profiling, but cannot support the entirety of their resistance pattern. Nevertheless, this study has evaluated the presence of class 1 integrons in MDR BCC and the potential of integrons in AMR dissemination.
Compliance with ethical standards: The Burkholderia isolates used in the study were obtained from the institutional repository. However, all relevant ethical standards were considered before conducting the experiments.
CONCLUSION
In conclusion, BCC, an opportunistic pathogen, poses a significant threat to immunocompromised individuals due to its propensity to cause severe infections. The inherent resistance of BCC to a broad spectrum of antibiotics remains a formidable challenge, necessitating urgent attention and intervention. Integron-mediated resistance is likely a key contributor to the antimicrobial resistance observed in these isolates, underscoring the need to further explore the genetic mechanisms at play. Moreover, HGT mechanisms, which facilitate the dissemination of resistance genes, must be rigorously monitored. This continuous surveillance is crucial for developing and implementing robust AMR management strategies, which are essential to mitigate the growing threat BCC poses in clinical settings.
Acknowledgment
The authors would like to thank Nitte University Centre for Science Education and Research, NITTE (Deemed to be University), for providing the necessary facilities and research fellowships.
Ethical approval
The study approved by the Institutional Ethics Committe, at Nitte University Centre for Science Education and Research, number INST.EC/2018-19/003, dated 11th September 2019.
Declaration of patient consent
Patient’s consent not required as patients identity is not disclosed or compromised.
Financial support and sponsorship
Nil.
Conflicts of interest
There are no conflicts of interest.
Use of artificial intelligence (AI)-assisted technology for manuscript preparation
The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using the AI.
REFERENCES
- Distribution of Burkholderia cepacia complex species among isolates recovered from persons with or without cystic fibrosis. J Clin Microbiol. 2005;43:2926-8.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Genome-based classification of Burkholderia cepacia complex provides new insight into its taxonomic status. Biol Direct. 2020;15:6.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- The multifarious, multireplicon Burkholderia cepacia complex. Nat Rev Microbiol. 2005;3:144-56.
- [CrossRef] [PubMed] [Google Scholar]
- Comparative analysis of different methods used for molecular characterization of Burkholderia cepacia complex isolated from noncystic fibrosis conditions. Indian J Med Microbiol. 2022;40:74-80.
- [CrossRef] [PubMed] [Google Scholar]
- Proposal of Burkholderia gen. nov. and transfer of seven species of the genus Pseudomonas homology group II to the new genus, with the type species Burkholderia cepacia (Palleroni and Holmes 1981) comb. nov. Microbiol Immunol. 1992;36:1251-75.
- [CrossRef] [PubMed] [Google Scholar]
- Successful Treatment of persistent burkholderia cepacia complex bacteremia with ceftazidime-avibactam. Antimicrob Agents Chemother. 2018;62:e02213-17.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Burkholderia cepacia complex infections: More complex than the bacterium name suggest. J Infect. 2018;77:166-70.
- [CrossRef] [PubMed] [Google Scholar]
- A 17-year nationwide study of burkholderia cepacia complex bloodstream infections among patients in the United States veterans health administration. Clin Infect Dis. 2017;65:1253-9.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Overcoming an extremely drug resistant (XDR) pathogen: Avibactam restores susceptibility to ceftazidime for burkholderia cepacia complex isolates from cystic fibrosis patients. ACS Infect Dis. 2017;3:502-11.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Exploring the role of the Ω-loop in the evolution of ceftazidime resistance in the PenA β-lactamase from burkholderia multivorans, an Important cystic fibrosis pathogen. Antimicrob Agents Chemother. 2017;61:e01941-16.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Integrons as the potential targets for combating multidrug resistance in Enterobacteriaceae using CRISPR- Cas9 technique. J Appl Microbiol. 2023;134:lxad137.
- [CrossRef] [PubMed] [Google Scholar]
- Performance standards for antimicrobial susceptibility testing (33rd ed). CLSI supplement M100. Wayne, PA: CLSI; 2023. Available from https://clsi.org/shop/standards/m100/. [Last accessed 2024 December 21]
- Burkholderia cepacia complex: Emerging multihost pathogens equipped with a wide range of virulence factors and determinants. Int J Microbiol. 2011;2011:607575.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Management of cepacia syndrome with a combination of intravenous and inhaled antimicrobials in a non-cystic fibrosis pediatric patient. J Pediatr Pharmacol Ther. 2020;25:730-4.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Prevalence of class 1, 2 and 3 integrons among multidrug-resistant pseudomonas aeruginosa in Yazd, Iran. Iran J Microbiol. 2018;10:300-6.
- [PubMed] [PubMed Central] [Google Scholar]
- Class 1 integrons as predominant carriers in escherichia coli isolates from waterfowls in Hainan, China. Ecotoxicol Environ Saf. 2019;183:109514.
- [CrossRef] [PubMed] [Google Scholar]
- Comparison of integron mediated antimicrobial resistance in clinical isolates of escherichia coli from urinary and bacteremic sources. BMC Microbiol. 2024;24:102.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Discovering genomics, proteomics, and bioinformatics. Benjamin-Cummings Publishing Company; 2007.
- Prevalence of class 1 integron and its gene cassettes carrying antibiotic resistance genes in drinking water treatment and distribution systems. Front Environ Sci Eng. 2024;18
- [CrossRef] [Google Scholar]
- Distribution diversity and expression regulation of class 1 integron promoters in clinical isolates of Morganella morganii. Front Microbiol. 2024;15:1459162.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Integrons in Enterobacteriaceae: Diversity, distribution and epidemiology. Int J Antimicrob Agents. 2018;51:167-76.
- [CrossRef] [PubMed] [Google Scholar]
- The integron: Adaptation on demand. Microbiol Spectr. 2015;3:MDNA3-0019.
- [CrossRef] [PubMed] [Google Scholar]
- Antimicrobial resistance and molecular characterization of gene cassettes from class 1 integrons in escherichia coli strains. Microb Drug Resist. 2022;28:413-8.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Efflux-mediated aminoglycoside and macrolide resistance in Burkholderia pseudomallei. Antimicrob Agents Chemother. 1999;43:465-70.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Antibiotic resistance in Burkholderia species. Drug Resist Updat. 2016;28:82-90.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Melioidosis: Insights into the pathogenicity of Burkholderia pseudomallei. Nat Rev Microbiol. 2006;4:272-82.
- [CrossRef] [PubMed] [Google Scholar]
- Frequency of class 1 integron in Escherichia coli strains isolated from patients with urinary tract infections in north of iran. Mater Sociomed. 2015;27:10-2.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Emergence of class 1 to 3 integrons among members of Enterobacteriaceae in Egypt. Microb Pathog. 2017;112:50-6.
- [CrossRef] [PubMed] [Google Scholar]
- Detection of class 1 integrons in Salmonella Weltevreden and silent antibiotic resistance genes in some seafood‐associated nontyphoidal isolates of Salmonella in South‐West coast of India. J Appl Microbiol. 2012;112:1113-22.
- [CrossRef] [PubMed] [Google Scholar]

