Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Brief Report
Case Report
Case Series
Current Issue
Editorial
Erratum
Guest Editorial
Letter to the Editor
Media & News
Narrative Review
Notice of Retraction
Original Article
Original Research
Review Article
Short Communication
Short Communications
Systematic Review and Meta-analysis
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Brief Report
Case Report
Case Series
Current Issue
Editorial
Erratum
Guest Editorial
Letter to the Editor
Media & News
Narrative Review
Notice of Retraction
Original Article
Original Research
Review Article
Short Communication
Short Communications
Systematic Review and Meta-analysis
View/Download PDF

Translate this page into:

Original Article
ARTICLE IN PRESS
doi:
10.25259/JHS-2024-10-12-(1616)

Optimisation of Culture Conditions for Expansion of Human Epidermal Stem Cells

Nitte University Centre for Stem Cell Research and Regenerative Medicine, K. S. Hegde Medical Academy, Nitte (Deemed to be University), Deralakatte, Mangaluru, Karnataka, India
Department of Plastic Surgery, K. S. Hegde Medical Academy, Nitte (Deemed to be University), Deralakatte, Mangaluru, Karnataka, India
Department of Dermatology, Venereology and Leprosy, K. S. Hegde Medical Academy, Nitte (Deemed to be University), Deralakatte, Mangaluru, Karnataka, India.

* Corresponding author: Dr. Mohana Kumar Basavarajappa, Nitte University Centre for Stem Cell Research and Regenerative Medicine, K. S. Hegde Medical Academy, Nitte (Deemed to be University), Deralakatte, Mangaluru, Karnataka, India. mohanakumar@nitte.edu.in

Licence
This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-Share Alike 4.0 License, which allows others to remix, transform, and build upon the work non-commercially, as long as the author is credited and the new creations are licensed under the identical terms.

How to cite this article: Swamy VE, Shetty N, Shetty V, Noronha TM, Shetty J, Basavarajappa MK. Optimisation of Culture Conditions for Expansion of Human Epidermal Stem Cells. J Health Allied Sci NU. doi: 10.25259/JHS-2024-10-12-(1616)

Abstract

Objectives

The present study attempted to optimise in vitro culture methods for establishing a homogeneous population of human epidermal stem cells (EpSCs).

Material and Methods

Human skin samples were obtained with informed written consent taken priorly to. The isolation and expansion of EpSCs was performed by explant and suspension methods using different culture media (Minimum essential medium (MEM α) and EpiLife) with supplementation of foetal bovine serum (FBS at 0, 10, and 20%) and growth factors [2 ng/mL keratinocyte growth factor, (KGF) and 2 ng/mL epidermal growth factor (EGF), 1% human keratinocyte growth supplement (HKGS)]. EpSCs were analysed for distinct biological features, such as self-renewal ability, cell cycle status, and cytogenetic stability. Further, the cells were quantitatively assessed for stem cell and differentiation marker expressions.

Results

Among the culture methods, explant culture showed the attachment of cells in MEM-α at 20% FBS supplementation by exhibiting a typical “cobblestone” epithelial pattern of growth at passage 0, but did not retain a similar morphology at passage 1. In contrast, no cells were firmly attached in suspension culture, either in MEM-α, at all concentrations of FBS. Interestingly, a higher number of proper EpSCs from suspension culture was observed when MEM-α was supplemented with FBS and growth factors, such as KGF, EGF, and HKGS. In EpiLife media with HKGS, the primary culture did not support the attachment of cells. Whereas, the EpiLife media supplemented with KGF, EGF, and HKGS resulted in the correct attachment of EpSCs with typical morphological features. EpSCs established from MEM-α and EpiLife supplemented with growth factors were proliferative and had more cells in the quiescent phase of the cell cycle. The analyses showed that EpSCs had high clonogenic potential with varied levels of expression of selected markers, such as p63, SCA1, keratin 5 (KRT5), KRT14, KRT15, ITGA6, ITGB1, KRT1, KRT10, and filaggrin (FLG).

Conclusion

The study findings indicated that EpSCs established in MEM-α and EpiLife media with growth factors possess plasticity with high proliferation ability. Thus, EpSCs may represent an ideal source for skin regenerative medicine applications.

Keywords

Epidermal stem cells
Human
In vitro
Markers expression
Optimization

INTRODUCTION

The human skin has an extensive capacity for self-renewal and tissue repair and is composed of two layers: the epidermis and dermis.[1,2] In the adult skin epidermis, the stem cell compartment contains molecularly heterogeneous subpopulations whose relationship to the complete trajectory of differentiation remains unknown.[3.4] However, the use of cultured epidermal stem cells (EpSCs) to promote regeneration offers great potential for cell-based therapies.[3,5]

The isolation and expansion of human EpSCs under in vitro conditions is a critical technique, and a lack of optimised culture procedures limits the use of these skin equivalents for several skin-related treatments.[3] EpSCs were isolated from juvenile and adult human skin biopsies and proliferated in vitro by the addition of exogenous factors, including serum, calcium, growth factors, and others.[6,7] Hence, the defined media composition, along with the growth factors, will lead to a better yield of cells. The cultured human EpSCs have been studied in vitro on their basic biological characteristics and for in vitro toxicity testing, and are widely being investigated for the potential treatment of severe burns and wounds.[4,8]

Growth factors are important mediators for intercellular communication.[9] keratinocyte growth factor (KGF) has a potent mitogenic activity on skin keratinocytes, which regulates the migration and differentiation of these cells and protects them from various insults under stress conditions.[10,11] Epidermal growth factor (EGF) is strongly expressed in the basal layer surrounding epidermal keratinocytes and is involved in the regulation of proliferation and differentiation.[4,12,13] In the present study, the ideal media combination for the growth and expansion of EpSCs has been investigated along with the distinct biological features of EpSCs, such as self-renewal ability, slow-cycling nature, and cytogenetic status. Further, the present study characterised the cells qualitatively and quantitatively for stem cells and differentiation marker expressions. These included p63 and stem cell antigen-1 (SCA1) as markers for epithelial progenitors and interfollicular epidermis (IFE) keratinocytes; keratin 5 (KRT5), KRT14, and KRT15 as markers of EpSCs; integrin-α6 (ITGA6) and integrin-β1 (ITGB1) as markers of adhesiveness; and KRT1, KRT10, and filaggrin (FLG) as keratinocyte differentiating cell markers. With this, it is envisaged that the optimised method could be used for the isolation of EpSCs for enabling further studies on their applications in skin regenerative medicine.

MATERIAL AND METHODS

Collection and processing of skin samples

Human skin samples were obtained from discarded surgical material of patients undergoing plastic surgery. Samples were obtained after ethics committee approval, and informed consent was taken in accordance with the Declaration of Helsinki. Skin samples (n=4) were collected and transferred to the laboratory in a sterile tube containing Dulbecco’s phosphate-buffered saline (DPBS) (Gibco-Invitrogen, Life Technologies, Grand Island, NY, USA), supplemented with 100 U/mL penicillin and 100 μg/mL streptomycin (1X Pen-Strep, Gibco-Invitrogen). The tissues were washed thrice with DPBS containing antibiotics to remove any blood stains and then soaked in 70% ethanol for 30 sec, followed by rinsing twice with DPBS before further processing.

Isolation of EpSCs by explant culture

The skin sample was split into strips with a thickness of 1 mm. The tissue explant was placed in 0.1% collagenase type 1 (Gibco-Invitrogen) and incubated at 37°C for 30 min. The explant was then removed and placed in a culture dish with a small amount of Medium-alpha (MEM-α, Gibco-Invitrogen) containing foetal bovine serum (FBS) (Gibco-Invitrogen) at 0%, 10%, and 20% (Method 1). The culture dishes with explants were incubated at 37°C in 5% CO2 overnight to allow the attachment. The medium was replaced every three days, and upon reaching 70% confluency, the primary culture of EpSCs was subpassaged using 0.25% (w/v) trypsin-EDTA (Himedia, Mumbai, India) solution.

Isolation of EpSCs by suspension culture

After thorough washing of the skin in DPBS, it was cut into strips of 1 cm width using a scalpel and placed in 0.25% trypsin-EDTA incubation at 37°C for 1 h. The epidermis was separated from the dermis using a pair of forceps. The trypsinised tissue, along with cell suspension, was then placed in a petri dish, and the top layer of epidermis was scraped for the release of cells. An equal volume of FBS was added to inhibit the action of trypsin, and cells were dissociated into single-cell suspensions and filtered using a cell strainer. After centrifugation, the supernatant was discarded, and the cells were counted using a hemacytometer. The cells were resuspended in MEM-α containing 0%, 10%, and 20% FBS (Method 2) and seeded at a cell density of 1×105 cells/well in a 12-well dish. Further, plates were incubated in a humidified 5% CO2 atmosphere at 37°C. The medium was replaced every three days, and sub-passaged after reaching 70% confluency. In method 3, the suspension of cells was cultured in EpiLife growth medium supplemented with 1% human keratinocyte growth supplement (HKGS) (Gibco-Invitrogen) at primary culture (P0). In method 4, cells at P0 were allowed to grow in MEM-α supplemented with 20% FBS, 2 ng/mL KGF (Peprotech, NJ, USA), 2 ng/mL EGF (Biolegend, CA, USA), and 1% HKGS (Media 1), followed by subculture in the same media up to passage 4 (P4). In method 5, the primary culture of cells was established in MEM-α supplemented with 20% FBS, 2 ng/mL KGF, 2 ng/mL EGF and 1% HKGS, and then the cells were subcultured in EpiLife with 10% FBS, 2 ng/mL KGF, 2 ng/mL EGF, and 1% HKGS (Media 2) up to P4.

Morphology and viability assay

During the culture expansion, cells were observed for attachment and morphology at different passages under an inverted phase-contrast microscope (Olympus, Tokyo, Japan). The cell viability was performed by the 0.4% trypan blue (Gibco-Invitrogen) exclusion test at various passages using a haemocytometer.

Proliferation by MTT assay

Cells were seeded at an initial density of 1×105 cells/well in a 12-well plate and harvested on 3rd, 6th, 9th, and 12th day for methyl triazolyl tetrazolium (MTT, Himedia, India)-based assay. Briefly, 50 µL of 0.5 mg/mL MTT solution was added to each well and incubated for 4 h at 37°C. Later, the converted dye was dissolved by adding 300 µL of dimethyl sulfoxide (DMSO, Himedia) to each well, and the absorbance was measured at 570 nm in a microplate reader (Thermo Fisher Scientific, MA, USA).

Karyotype analysis

Cytogenetic stability of EpSCs was assessed by GTG banding on metaphase spreads after being cultured for 5 days in different media. Proliferating cells were arrested at metaphase II using 0.3 mg/mL colcemid (Gibco-Invitrogen) and harvested by 0.25% trypsin-EDTA. GTG banding was carried out using 1% Giemsa stain (Gibco-Invitrogen). Well-banded metaphase spreads were assessed using a fluorescence microscope (Olympus, Tokyo, Japan).

Cell cycle and markers analysis by flow cytometry

For cell cycle analysis, EpSCs at a confluency of 70-80% were trypsinised, washed with DPBS, and fixed with 70% cold ethanol. Cells were treated with 0.5 mg/mL RNase A (Himedia) and stained with 50 μg/mL propidium iodide (Gibco-Invitrogen) in the dark for 30 min at 37°C. DNA content was determined by flow cytometry (Partec-Cyflow, Munster, Germany). A minimum of 10,000 events were acquired per sample.

For marker expression, 3×105 cells were fixed with 3.7% paraformaldehyde for 30 min and permeabilised with 0.1% Triton X-100 for 20 min. Then, the cells were incubated in unconjugated primary antibodies, pancytokeratin (KRT1, Novus Biologicals, USA, 1:100), KRT10 (Novus Biologicals, 1:100), FLG (Novus Biologicals, 1:100), and CD29 (E-bioscience, USA, 1:100) for 1 h at 37°C. Further, the cells were stained with fluorescein isothiocyanate (FITC)-conjugated anti-mouse IgG (E-bioscience, 1:100) as a secondary antibody and incubated in the dark for 1 hour at room temperature. Isotype controls were kept in parallel, and at least 10,000 events were acquired and analysed (Partec-Cyflow).

qPCR

To analyse the expression of the markers, EpSCs cultured in different media were harvested. Total RNA was extracted using RNAiso Plus kit (Takara, Tokyo, Japan), and cDNA was synthesised by Primescript RT Reagent kit (Takara) according to the manufacturer’s instructions. Quantitative expression of specific genes was analysed using the StepOnePlus™ real-time PCR System (Applied Biosystems, Thermo Fisher Scientific, USA). The reaction mixture for q-PCR analysis consisted of SYBR® Premix Ex Taq TM II (Takara) along with forward and reverse primers and the template cDNA. Quantitative polymerase chain reaction (qPCR) was performed along with the negative controls at the annealing temperature set at 60°C. The CT values of control samples (genes expressed in cDNA directly isolated from skin) were used to calculate the relative quantification (RQ or 2-∆∆CT) of mRNA levels in EpSCs. CT values of all the target genes were normalised against the housekeeping gene. The primer sequences of the genes have been presented in Table 1.

Table 1: Primer sequences used for qPCR.
Gene Forward primer Reverse primer Product length (bp)
P63 AGTCCAGAGGTTTTCCAGCA GAGGAGCCGTTCTGAATCTG 236
SCA1 GTACTGAAACCCCTCCCTCTTC CTGCACAGATAAAACCTAGCAGCTC 163
KRT5 GCTGCCTACATGAACAAGGTGG ATGGAGAGGACCACTGAGGTGT 140
KRT14 CAGTTCACCTCCTCCAGCTC GAGGTTCTGCATGGTCACCT 348
KRT15 GAGAACTCACTGGCCGAGAC CTGAAGAGGCTTCCCTGATG 244
ITGA6 TTGAATATACTGCTAACCCCG TCGAAACTGAACTCTTGAGGATAG 113
ITGB1 GAAGGGTTGCCCTCCAGA GCTTGAGCTTCTCTGCTGTT 107
KRT1 CAGCATCATTGCTGAGGTCAAGG CATGTCTGCCAGCAGTGATCTG 119
KRT10 CCTGCTTCAGATCGACAATGCC ATCTCCAGGTCAGCCTTGGTCA 153
FLG TGATGGTATTCAAGTTGGCTCA TGTTTCTCTTGGGCTCTTGG 215

qPCR: Quantitative polymerase chain reaction, bp: Base pairs, P63: Tumor protein p63, SCA1: Stem cell antigen-1, KRT: Keratin, ITGA6: Integrin-α6, ITGB1: Integrin-β1, FLG: Filaggrin.

Statistical analysis

Results are presented as the mean ± standard deviation (SD). Statistical analysis was performed by one-way or two-way analysis of variance (ANOVA) using GraphPad Prism 9.12 (GraphPad, CA, USA). p < 0.05 was considered statistically significant.

RESULTS

Morphology of EpSCs isolated by explant culture

In method 1, the tissue explants incubated in MEM-α supplemented with or without 10% FBS did not generate the primary culture even after 12 days [Figures 1a and b] respectively. However, in 20% FBS-supplemented dishes, cells slowly released from the explants by day 10, and a firm plastic adherence with the morphology of keratinocytes was observed by day 18 [Figure 1c]. These EpSCs exhibited a typical “cobblestone” or “pavement stone” epithelial pattern of growth. The mass of cell outgrowths appeared as rings around the explant that were tightly packed and strongly adhesive, with continuous expansion. When these cells were subcultured in 20% FBS, they were unable to sustain the keratinocyte morphological features and appeared with fibroblast-like morphology [Figure 1d].

(a and b) Morphology of EpSCs isolated by explant culture. Tissue explants in MEM-α supplemented with no or 10% FBS did not generate the primary culture; (c) In 20% FBS, cells showed a firm plastic adherence with the morphology of keratinocytes by day 18; (d) Cells in 20% FBS were unable to sustain the keratinocyte features and displayed fibroblast-like morphology. EpSCs: Epidermal stem cells, FBS: Foetal bovine serum, MEM-α: Alpha minimum essential medium. Images magnification is 4x.
Figure 1: (a and b) Morphology of EpSCs isolated by explant culture. Tissue explants in MEM-α supplemented with no or 10% FBS did not generate the primary culture; (c) In 20% FBS, cells showed a firm plastic adherence with the morphology of keratinocytes by day 18; (d) Cells in 20% FBS were unable to sustain the keratinocyte features and displayed fibroblast-like morphology. EpSCs: Epidermal stem cells, FBS: Foetal bovine serum, MEM-α: Alpha minimum essential medium. Images magnification is 4x.

Morphology of EpSCs isolated by suspension culture

In suspension culture, the cells grown in MEM-α supplemented with 0%, 10%, and 20% FBS (Method 2) did not show any attachment to the plastic culture dish and remained in suspension [Figure 2a]. Further, the cells did not proliferate into colonies and, hence, could not be sub-passaged. In method 3, cells incubated in suspension with EpiLife containing HKGS also showed similar results as in method 2 of suspension culture [Figure 2b].

Morphology of EpSCs isolated by suspension culture. (a) Cells in MEM-α with 0%, 10%, and 20% FBS (Method 2) did not show any attachment; (b) In method 3, cells in EpiLife media containing HKGS also showed similar features; (c) In method 4, cells in MEM-α, consisting of 20% FBS along with the growth factors (designated as Media 1), exhibited a typical “cobblestone” pattern of growth; (d) Polygonal-shaped cells possessing prominent cantered nuclei; (e) In method 5, cells cultured in MEM-α with 20% FBS and growth supplements displayed similar features as method 4; (f) Cells subcultured (P1) in EpiLife with HKGS (designated as Media 2) did not show typical cobblestone morphology. EpSCs: Epidermal stem cells, FBS: Foetal bovine serum, HKGS: Human keratinocyte growth supplement, MEM-α: Alpha minimum essential medium. Images magnification is 4x.
Figure 2: Morphology of EpSCs isolated by suspension culture. (a) Cells in MEM-α with 0%, 10%, and 20% FBS (Method 2) did not show any attachment; (b) In method 3, cells in EpiLife media containing HKGS also showed similar features; (c) In method 4, cells in MEM-α, consisting of 20% FBS along with the growth factors (designated as Media 1), exhibited a typical “cobblestone” pattern of growth; (d) Polygonal-shaped cells possessing prominent cantered nuclei; (e) In method 5, cells cultured in MEM-α with 20% FBS and growth supplements displayed similar features as method 4; (f) Cells subcultured (P1) in EpiLife with HKGS (designated as Media 2) did not show typical cobblestone morphology. EpSCs: Epidermal stem cells, FBS: Foetal bovine serum, HKGS: Human keratinocyte growth supplement, MEM-α: Alpha minimum essential medium. Images magnification is 4x.

In method 4, the morphology in primary culture (P0) grown with the media MEM-α, consisting of 20% FBS along with the growth factors (designated as Media 1), exhibited keratinocytes in a typical “cobblestone” epithelial pattern of growth [Figure 2c]. At P2, a few cells showed fibroblast-like features, whereas most of them were consistent with keratinocyte morphology as well as polygonal-shaped cells possessing prominent cantered nuclei [Figure 2d].

In method 5, cells cultured in MEM-α with 20% FBS and growth supplements [Figure 2e] at P0 displayed similar results to method 4. When these cells were sub-cultured (P1) in EpiLife supplemented with HKGS (designated as Media 2), most of the cells did not show typical cobblestone morphology but appeared with polygonal shapes consisting of prominent, centred nuclei [Figure 2f]. Based on these observations, it was decided to continue the further analyses of EpSCs cultured in media 1 and 2.

Viability

The viability of EpSCs was determined at different passages, and any alteration in the viability during culture expansion was recorded. The values recorded from P1 to P5 for EpSCs in media 1 and media 2 varied from 87.33% to 94.67% and 88.83% to 95.50%, respectively [Figure 3a], with no significant (p > 0.05) differences.

Characteristics of EpSCs. (a) Viability; (b) MTT-based cell proliferation assay. All the values are presented as mean ± SD; (c) Karyotype of cells cultured in Media 1; (d) Karyotype of cells cultured in Media 2. EpSCs: Human epidermal stem cells. Media 1: MEM-alpha with 20% FBS (foetal bovine serum) and growth supplements; Media 2: EpiLife with HKGS (human keratinocyte growth supplement). MEM: Minimum essential medium.
Figure 3: Characteristics of EpSCs. (a) Viability; (b) MTT-based cell proliferation assay. All the values are presented as mean ± SD; (c) Karyotype of cells cultured in Media 1; (d) Karyotype of cells cultured in Media 2. EpSCs: Human epidermal stem cells. Media 1: MEM-alpha with 20% FBS (foetal bovine serum) and growth supplements; Media 2: EpiLife with HKGS (human keratinocyte growth supplement). MEM: Minimum essential medium.

Proliferation rate

The proliferation of EpSCs was examined using two different growth media. It was evident that the absorbance value was directly proportional to the cell number, which was expected to increase with culture duration [Figure 3b]. Up to day 3, cell proliferation was slower. However, by day 6 and 9, the cell proliferation entered the logarithmic phase and showed rapid growth. By day 12, the cell numbers were found to have decreased or remained stationary. The growth of EpSCs was almost similar in both media, and thus, there was no significant (p > 0.05) difference in the proliferation rates.

Karyotyping

Cytogenetic stability of EpSCs was determined by GTG banding. The results demonstrated normal ploidy, signifying that no chromosomal abnormalities were induced during the culture of EpSCs in media 1 and media 2 [Figures 3c and d] respectively.

Cell cycle status and expression of markers

EpSCs in media 1 exhibited 78.18% of cells in the G0/G1 phase [Figure 4a], whereas EpSCs in media 2 had 68.78% of cells [Figure 4b]. Further, in media 1, EpSCs showed 14.29% and 1.93% of cells in the S-phase and G2/M phase, respectively. EpSCs in media 2 exhibited 20.13% of cells in the S-phase and 3.18% of cells in the G2/M phase.

Cell cycle status and expression of markers in EpSCs analysed by flow cytometer. Cell cycle status of EpSCs in (a) Media 1 and (b) Media 2. Expression of markers in EpSCs cultured in (c) Media 1 and (d) Media 2. EpSCs: Human epidermal stem cells. Media 1: MEM-alpha with 20% FBS (foetal bovine serum) and growth supplements; Media 2: EpiLife with HKGS (human keratinocyte growth supplement). MEM: Minimum essential medium.
Figure 4: Cell cycle status and expression of markers in EpSCs analysed by flow cytometer. Cell cycle status of EpSCs in (a) Media 1 and (b) Media 2. Expression of markers in EpSCs cultured in (c) Media 1 and (d) Media 2. EpSCs: Human epidermal stem cells. Media 1: MEM-alpha with 20% FBS (foetal bovine serum) and growth supplements; Media 2: EpiLife with HKGS (human keratinocyte growth supplement). MEM: Minimum essential medium.

The percentage expression of markers in EpSCs showed varied levels of KRT1 (1.96% and 0.78%), KRT10 (1.68% and 0.09%), FLG (0.77% and 0.29%), and CD29 (88.98% and 48.42%) cultured in media 1 and media 2, respectively [Figures 4c and d]. The cells cultured in media 1 and media 2 were characterised by very low expression of differentiation markers, such as K1, K10, and FLG, when compared with the key stem cell marker, CD29 (ITGB-1).

Expression of markers by qPCR

qPCR was performed to analyse the expression levels of selected markers, such as p63, SCA1, KRT5, KRT14, KRT15, ITGA6, ITB1, KRT1, KRT10, and FLG implicated in the stemness and self-renewability, adhesiveness, and differentiation status of EpSCs cultured in media 1 and media 2. qPCR results indicated that though there was a slightly higher expression of all the markers in EpSCs cultured in media 2 compared to media 1, no significant (p > 0.05) differences in their levels were observed [Figure 5].

qPCR analysis of selected genes in EpSCs. Relative expression of p63 and stem cell antigen-1 (SCA1) as markers for epithelial progenitors and keratinocytes, keratin 5 (KRT5), KRT14 and KRT15 as markers of EpSCs, integrin-α6 (ITGA6) and integrin-β1 (ITB1) as markers of adhesiveness, and KRT1, KRT10, and filaggrin (FLG) as keratinocyte differentiating cell markers. No significant (P>0.05) differences were observed. Data are expressed as mean ± standard deviation (SD). qPCR: Quantitative polymerase chain reaction, EpSCs: Human epidermal stem cells. Media 1: MEM-alpha with 20% FBS (foetal bovine serum) and growth supplements; Media 2: EpiLife with HKGS (human keratinocyte growth supplement). MEM: Minimum essential medium.
Figure 5: qPCR analysis of selected genes in EpSCs. Relative expression of p63 and stem cell antigen-1 (SCA1) as markers for epithelial progenitors and keratinocytes, keratin 5 (KRT5), KRT14 and KRT15 as markers of EpSCs, integrin-α6 (ITGA6) and integrin-β1 (ITB1) as markers of adhesiveness, and KRT1, KRT10, and filaggrin (FLG) as keratinocyte differentiating cell markers. No significant (P>0.05) differences were observed. Data are expressed as mean ± standard deviation (SD). qPCR: Quantitative polymerase chain reaction, EpSCs: Human epidermal stem cells. Media 1: MEM-alpha with 20% FBS (foetal bovine serum) and growth supplements; Media 2: EpiLife with HKGS (human keratinocyte growth supplement). MEM: Minimum essential medium.

DISCUSSION

In this study, the optimisation was performed by comparing the explant and the suspension cultures, different kinds of media components, and the supplementation of growth factors. Initial attempts were made to standardise the media using explant culture (method 1) with 0%, 10%, and 20% FBS supplementation. The cells in the primary culture of explants were observed only in MEM-α supplemented with 20% FBS and failed to show any adherence or growth in 0% and 10% FBS concentrations. Further, the downside of cells cultured in 20% FBS was the outgrowing number of fibroblasts, as observed previously.[14,15] However, the explant method for keratinocyte culture using EpiLife showed serial outgrowths of keratinocytes in larger numbers.[14] With these observations, the explant method with MEM-α was discontinued.

EpSCs in suspension culture, comprised of MEM-α with 0%, 10%, and 20% concentrations of FBS (Method 2), and EpiLife supplemented with HKGS (Method 3), were unable to attach to the culture plates. Previously, EpiLife media supported the derivation and expansion of primary epidermal cells in vitro.[14] In contrast, the use of EpiLife failed to support the stratification and differentiation of keratinocytes in the absence of serum.[16] In this study, even in the presence of serum, the cells did not show adherence characteristics and were devoid of exhibiting any proliferative features. Hence, both methods were excluded from further assays.

In method 4, MEM-α with 20% FBS consisting of KGF, EGF, and HKGS (Media 1) enhanced the attachment of cells that exhibited proper cobblestone morphology. Similarly, in method 5, primary cells established in MEM-α with growth factors and subcultured in commercially available EpiLife supplemented with HKGS (Media 2) showed localised, small polygonal features. EpSCs thus derived in media 1 and 2 were maintained continuously in the presence of serum and growth factors and used for subsequent analyses.

Earlier studies explored the development of nutritionally standardised and defined culture conditions for EpSCs and keratinocytes.[3,4,14,16,17] Although keratinocytes were cultured with no serum supplement and feeder-layer support, the expansion and enrichment of EpSCs are quite challenging because of the lack of specific biomarkers to differentiate EpSCs from other proliferative cells of skin tissue.[14,15,18] Hence, the present study investigated the combination of feeder-free media with growth factors for offering an improved isolation and culture method for EpSCs.

An assessment of viability and the proliferative ability of EpSCs provides us with quantitative data to identify the basis of their growth characteristics in vitro.[5,8] In this study, media 1 and 2 clearly supported a significant number and higher proliferative rate of EpSCs with no noticeable differences as analysed up to passage 5. The maximum cell number was recorded on day 12, and a slightly higher proliferation was observed with media 1 than with media 2. The reason for these minor differences in growth rate could be related to the composition of EpiLife manufactured for multi-tissue source EpSCs expansion.[14] Notably, when the proportion of EpSCs was expanded, the number of cells that underwent terminal differentiation remained constant, as both media resulted in an epidermal population enriched with proliferative cells.[19] Thus, the suspension culture-derived EpSCs were expanded rapidly to later passages in media 1 and media 2. In the present study, the culturing conditions of EpSCs have been improved by adding growth factors to enable their survival and clonal growth in cultures yielding a homogenous population.

In this study, the GTG banding assay further indicated that expanded EpSCs did not display any unbalanced chromosomal rearrangements, including deletion or duplication. Earlier studies underscored the importance of cytogenetic stability in culture-expanded tissue-specific stem cells, as autologous skin grafts from EpSCs offer many clinical applications.[20] Hence, it is highly imperative to consider the factors, such as tissue source, culture conditions, and duration, that influence the genetic stability of EpSCs.

Stem cells are known to be the quiescent niche with varied numbers progressing through different phases of the cell cycle.[17] This indicates that most of the EpSCs are quiescent or exist in the G0 stage of the cell cycle. In this study, the data showed a higher number of EpSCs at the G0/G1 phase with fewer cells at the S- and G2M phases in both media 1 and 2. It is assumed that EpSCs in IFE constantly self-renew to provide a new protective layer at the skin surface, and cell replacement and regeneration occur in the context of maintaining tissue homeostasis.[2,3,17,21,22] Since cell proliferation is closely related to the cell cycle, our data support the findings that the majority of EpSCs reside in the G0/G1 phase, and these slow-cycling cells can switch reversibly between quiescence and activity following the situation encountered.[21,22]

It is known that EpSCs play a major role as a potential source for skin reconstruction.[2,4] Hence, we assessed the EpSCs on the expression of marker genes to obtain further insight into the molecular properties. qPCR results showed a slightly higher expression of all the markers in EpSCs cultured in media 2 compared to media 1, but no significant (p > 0.05) differences in their levels were recorded. The involvement of EpSCs, expressing the transcription factor p63, is shown to be involved in epidermis stratification or the addition of new cell layers.[23,24] SCA1 has been used as a positive marker to isolate stem or progenitor cells from epidermal tissues.[25] The expression of these genes is critical in EpSCs to replenish the stem cell pool and produce committed progenitors.[23]

Keratins have long been identified as biochemical markers of cutaneous stem cells.[5,26] The characterisation of skin tissue stem cell population remains a difficult task, and hence, a panel of phenotypic markers distinguishing differentiated cells from progenitors was analysed in this study. KRT5, KRT14, and KRT15 as markers of EpSCs, and KRT1, KRT10, and FLG as markers of differentiating cells, were expressed as they are still being used to distinguish stem cells from the transit amplifying and committed keratinocyte progenitor.[4,5,26] Considering the notion that selected keratins as markers for stem and progenitor cells, the expression intensity in EpSCs could be a parameter to define and predict their potency in vitro.

It is well-established that stem cells can be segregated from differentiated keratinocytes based on the expression of integrins, as they have a pivotal role in regulating epidermal adhesion, growth, and differentiation.[5,27] ITGA6 has been identified as the common molecular marker expressed in stem cell signatures, thus indicating its important role as a transmembrane receptor. Further, a constitutive ITGB1-positive cell population also contains heterogeneous stem cells, and its expression, along with keratins, would enable their functional identity in ex vivo cultures.[5] Our results strongly showed the expression of both integrins in EpSCs cultured in media 1 and 2, supporting the fact that they have a role in maintaining the stem cell compartment under in vitro conditions.[3,4,28]

CONCLUSION

The present study findings illustrated that established EpSCs in MEM-α and EpiLife media with supplemented growth factors possess plasticity and high proliferation ability. However, we could optimise the EpSCs expansion in a short-term culture of up to passage 5. Hence, the maintenance of potency and defining properties in long-term cultures needs to be ascertained as a step forward for using EpSCs as an ideal autologous source for skin regenerative applications.

Ethical approval

The research/study approved by the Central Ethics Committee, at Nitte (Deemed to be University), number NU/CEC/2018/0176b, dated 19th January 2018.

Declaration of patient consent

The authors certify that they have obtained all appropriate patient consent forms. In the form, the patient has given consent for clinical information to be reported in the journal. The patient understands that the patient’s names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.

Financial support and sponsorship

The study was funded by Nitte (Deemed to be University), NUFR/2017/06.

Conflicts of interest

There are no conflicts of interest.

Use of artificial intelligence (AI)-assisted technology for manuscript preparation

The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using AI.

REFERENCES

  1. , . Interfollicular epidermal homeostasis: dicing with differentiation. Exp Dermatol. 2012;21:249-53.
    [CrossRef] [PubMed] [Google Scholar]
  2. , , , , , . Emergence and properties of adult mammalian epidermal stem cells. Dev Biol. 2024;515:129-38.
    [CrossRef] [PubMed] [Google Scholar]
  3. , , , , , , et al. Progress in studies of epidermal stem cells and their application in skin tissue engineering. Stem Cell Res Ther. 2020;11:303.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  4. , , , , , , et al. Epidermal stem cells: skin surveillance and clinical perspective. J Transl Med. 2024;22:779.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  5. , , , , , . Epidermal stem cells in wound healing and their clinical applications. Stem Cell Res Ther. 2019;10:229.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  6. , . Serial cultivation of strains of human epidermal keratinocytes: the formation of keratinizing colonies from single cells. Cell. 1975;6:331-43.
    [CrossRef] [PubMed] [Google Scholar]
  7. , , , , , , et al. A Newly Developed Chemically Defined Serum-Free Medium Suitable for Human Primary Keratinocyte Culture and Tissue Engineering Applications. Int J Mol Sci. 2023;24:1821.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  8. , , . Cultured epidermal stem cells in regenerative medicine. Stem Cell Res Ther. 2017;8:155.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  9. , , , , , . Purification and characterization of a newly identified growth factor specific for epithelial cells. Proc Natl Acad Sci U S A. 1989;86:802-6.
    [CrossRef] [PubMed] [Google Scholar]
  10. , , , , , , et al. The function of KGF in morphogenesis of epithelium and reepithelialization of wounds. Science. 1994;266:819-22.
    [CrossRef] [PubMed] [Google Scholar]
  11. , . Cellular and molecular mechanisms of skin wound healing. Nat Rev Mol Cell Biol. 2024;25:599-616.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  12. , , , . Beyond wavy hairs: The epidermal growth factor receptor and its ligands in skin biology and pathology. Am J Pathol. 2008;173:14-24.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  13. , , , , . Epidermal growth factor improves the migration and contractility of aged fibroblasts cultured on 3D collagen matrices. Int J Mol Med. 2015;35:1017-25.
    [CrossRef] [PubMed] [Google Scholar]
  14. , . An improved method of human keratinocyte culture from skin explants: cell expansion is linked to markers of activated progenitor cells. Exp Dermatol. 2009;18:720-6.
    [CrossRef] [PubMed] [Google Scholar]
  15. , , , , . Comparison of the enzymatic and explant methods for the culture of keratinocytes isolated from human foreskin. Biomed Rep. 2015;3:304-8.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  16. , . Keratinocytes propagated in serum-free, feeder-free culture conditions fail to form stratified epidermis in a reconstituted skin model. PLoS One. 2013;8:e52494.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  17. , , , , . Isolating a pure population of epidermal stem cells for use in tissue engineering. Exp Dermatol. 2001;10:45-54.
    [CrossRef] [PubMed] [Google Scholar]
  18. , , , , , , et al. Culture of keratinocytes for transplantation without the need of feeder layer cells. Cell Transplant. 2007;16:649-61.
    [CrossRef] [Google Scholar]
  19. , , , , , , et al. Isolation and clonal analysis of human epidermal keratinocyte stem cells in long-term culture. Stem Cells. 2003;21:481-94.
    [CrossRef] [PubMed] [Google Scholar]
  20. . Genetic Stability of Mesenchymal Stromal Cells for Regenerative Medicine Applications: A Fundamental Biosafety Aspect. Int J Mol Sci. 2019;20:2406.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  21. , , , , , , et al. Distinct contribution of stem and progenitor cells to epidermal maintenance. Nature. 2012;489:257-62.
    [CrossRef] [PubMed] [Google Scholar]
  22. , , , , , , et al. Gradual differentiation uncoupled from cell cycle exit generates heterogeneity in the epidermal stem cell layer. Nat Cell Biol. 2022;24:1692-700.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  23. , . Concise review: Stem cell antigen-1: Expression, function, and enigma. Stem Cells. 2007;25:1339-47.
    [CrossRef] [PubMed] [Google Scholar]
  24. , , , , , , et al. p63: a crucial player in epithelial stemness regulation. Oncogene. 2023;42:3371-84.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  25. , , . The role of stem cell antigen-1/Lymphocyte antigen 6A-2/6E-1 knock out in murine epidermis. Stem Cell Res. 2020;49:102047.
    [CrossRef] [PubMed] [Google Scholar]
  26. , , , . Keratin k15 as a biomarker of epidermal stem cells. Int J Mol Sci. 2013;14:19385-98.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  27. , . The Role of Integrin α6 (CD49f) in Stem Cells: More than a Conserved Biomarker. Stem Cells Dev. 2017;26:1090-9.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
  28. , , , . Isolation and long-term expansion of murine epidermal stem-like cells. PLoS One. 2021;16:e0254731.
    [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
Show Sections